version
PlantPromoterDB promoter information of J090082I08

Summary of Gene (J090082I08)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0244800        NCBI 
Gene model J090082I08  
Description NONE  
#
#

Overview

Focused view (chromosome 4: 9416809-9415610)

Genome position     
from initiation codon
009-066-G06         
011-024-D02         
AK121488            
J023095P14          
J023150J09          
J053097G24          
J065001K24          
J065009O13          
J065076M12          
J065081I15          
J065105E10          
J065106G04          
J065123I12          
J065137H16          
J065151I11          
J065164H06          
J065173J07          
J065196F02          
J065198I17          
J065216J02          
J075076D10          
J075098F06          
J075115A20          
J075184H05          
J075193E17          
J090014L09          
J090015H16          
J090024M04          
J090062K08          
TSS from cDNA
TSS information
J090082I08                       5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J090082I08

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-9415947-138

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGTGGATG-94160029416009-193-200
 OsREG515GGTGGATG PPDB Motif  PLACE Motif 
REGGCCCACGTGTC-94160189416028-209-219
 OsREG449GCCCACGT    PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG508 CCCACGTG   PPDB MotifACGT  PLACE Motif 
 OsREG434  CCACGTGT  PPDB MotifACGT  PLACE Motif 
 OsREG509   CACGTGTC PPDB MotifACGT  PLACE MotifACGTGKC 
REGCGTGTGGGCCCCA-94161259416137-316-328
 OsREG526CGTGTGGG      PPDB MotifGCCCA  PLACE Motif 
 OsREG598 GTGTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG627  TGTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GTGGGCCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG647    TGGGCCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG641     GGGCCCCA PPDB MotifGCCCA  PLACE Motif 
REGCCCACGTGGC-94161499416158-340-349
 OsREG508CCCACGTG   PPDB MotifACGT  PLACE Motif 
 OsREG507  CACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.