version
PlantPromoterDB promoter information of J090085N22

Summary of Gene (J090085N22)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0854800        NCBI 
Gene model J090085N22  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 36858304-36857105)

Genome position     
from initiation codon
009-101-G03         
AK060748            
AK062754            
AK072499            
J013035G13          
J013094H23          
J013108N19          
J013130C20          
J013170B06          
J023055N08          
J023068K14          
J023080G02          
J023098C09          
J023125E22          
J033025K19          
J033055L07          
J033081G11          
J033091J10          
J033093C20          
J033122A16          
J065034J10          
J065061L21          
J065082K13          
J065088O18          
J065100A16          
J065130G12          
J065161G10          
J090004D14          
J090007D13          
J090028E18          
J090041L12          
J100046N10          
J100047F13          
J100075B13          
J100084E19          
TSS from cDNA
TSS information
J090085N22                       5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J090085N22

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakTclone-36858210-906
TSS clone peakCclone-36858201-897
TSS clone peakAclone-36857947-643

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTTCCTCTCTCTCT-3685790436857918-600-614
Y PatchTCCTCCTCCTCC-3685817436858185-870-881
Y PatchTCCCCCTCCCCTCCTCTCCTTTCCTCTC-3685819736858224-893-920
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCGGCCCACGGG-3685809336858105-789-801
 OsREG615GCCGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG564  CGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG571   GGCCCACG   PPDB MotifGCCCA  PLACE Motif 
 OsREG547    GCCCACGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG531     CCCACGGG PPDB MotifGCCCA, ACGGGC  PLACE Motif 
REGCTCCCCCA-3685812236858129-818-825
 OsREG574CTCCCCCA PPDB Motif  PLACE Motif 
REGACAGCCCACAC-3685830136858311-997-1007
 OsREG435ACAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG461  AGCCCACA  PPDB MotifGCCCA  PLACE Motif 
 OsREG598   GCCCACAC PPDB MotifGCCCA  PLACE Motif 
REGCCGTCCGATC-3685832236858331-1018-1027
 OsREG545CCGTCCGA   PPDB Motif  PLACE Motif 
 OsREG484 CGTCCGAT  PPDB Motif  PLACE Motif 
 OsREG589  GTCCGATC PPDB Motif  PLACE Motif 
REGCACACACCACGCGTCC-3685833636858351-1032-1047
 OsREG499CACACACC         PPDB Motif  PLACE Motif 
 OsREG443      CCACGCGT   PPDB Motif  PLACE Motif 
 OsREG442        ACGCGTCC PPDB Motif  PLACE Motif 
REGCCACGGCCC-3685840836858416-1104-1112
 OsREG521CCACGGCC  PPDB Motif  PLACE Motif 
 OsREG504 CACGGCCC PPDB MotifGCCCA  PLACE Motif 
REGCGCCACGTCAC-3685848836858498-1184-1194
 OsREG448CGCCACGT    PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG585 GCCACGTC   PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG505   CACGTCAC PPDB MotifACGT  PLACE MotifTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.