version
PlantPromoterDB promoter information of J090088G19

Summary of Gene (J090088G19)

Organism Oryza sativa  
Chromosome 9  
Locus Os09g0527900        NCBI 
Gene model J090088G19  
Description NONE  
#
#

Overview

Focused view (chromosome 9: 21482370-21481171)

Genome position     
from initiation codon
AK122172            
J033148H23          
J080070L07          
TSS from cDNA
TSS information
J090088G19                       5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J090088G19

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-21481626-256

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCTCCC-2148159021481599-220-229
Y PatchTTCCTCCCTC-2148161421481623-244-253
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCCCACCAC-2148168421481693-314-323
 OsREG612GCCCCACC   PPDB Motif  PLACE Motif 
 OsREG527  CCCACCAC PPDB MotifGCCCA  PLACE Motif 
REGGGTGGGGCC-2148171621481724-346-354
 OsREG612GGTGGGGC  PPDB Motif  PLACE Motif 
 OsREG631 GTGGGGCC PPDB Motif  PLACE Motif 
REGGGTGGGGC-2148174021481747-370-377
 OsREG612GGTGGGGC PPDB Motif  PLACE Motif 
REGCGTGGACC-2148176021481767-390-397
 OsREG570CGTGGACC PPDB Motif  PLACE Motif 
REGTCTGGCCCCACCTGTCAGTG-2148189721481916-527-546
 OsREG638TCTGGCCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG631   GGCCCCAC          PPDB Motif  PLACE Motif 
 OsREG612    GCCCCACC         PPDB Motif  PLACE Motif 
 OsREG514      CCCACCTG       PPDB MotifGCCCA  PLACE Motif 
 OsREG436       CCACCTGT      PPDB Motif  PLACE Motif 
 OsREG501        CACCTGTC     PPDB Motif  PLACE Motif 
 OsREG551          CCTGTCAG   PPDB Motif  PLACE MotifTGAC 
 OsREG453           CTGTCAGT  PPDB Motif  PLACE MotifTGAC 
 OsREG510            TGTCAGTG PPDB Motif  PLACE MotifTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.