version
PlantPromoterDB promoter information of J090089A10

Summary of Gene (J090089A10)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0838800        NCBI 
Gene model J090089A10  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 37736622-37737821)

Genome position     
from initiation codon
AK066366            
AK073775            
J013067M01          
J033030I24          
TSS from cDNA
TSS information
J090089A10                       5'->3' (+)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J090089A10

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+37737498-124

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTCCTCCTCC+3773746937737480-153-142
Y PatchCCTCCTCCCCT+3773751037737520-112-102
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAATGGGCT+3773728937737296-333-326
 OsREG432AATGGGCT PPDB MotifGCCCA  PLACE Motif 
REGCCAGCCCAATA+3773736437737374-258-248
 OsREG523CCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG511 CAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG460  AGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG596   GCCCAATA PPDB MotifGCCCA  PLACE Motif 
REGTTATGGGCCGTTGTTTGGGCTTTGGGCCGGA+3773737637737406-246-216
 OsREG605TTATGGGC                        PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC                       PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG                      PPDB MotifGCCCA  PLACE Motif 
 OsREG445   TGGGCCGT                     PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG423    GGGCCGTT                    PPDB MotifGCCCA, AAACG(C/G)  PLACE Motif 
 OsREG494     GGCCGTTG                   PPDB MotifCCAACGG  PLACE Motif 
 OsREG593            GTTTGGGC            PPDB MotifGCCCA  PLACE Motif 
 OsREG457             TTTGGGCT           PPDB MotifGCCCA  PLACE Motif 
 OsREG426              TTGGGCTT          PPDB MotifGCCCA  PLACE Motif 
 OsREG421               TGGGCTTT         PPDB MotifGCCCA  PLACE Motif 
 OsREG625                    TTTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG563                     TTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542                      TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG644                       GGGCCGGA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.