version
PlantPromoterDB promoter information of J090090C15

Summary of Gene (J090090C15)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0708500        NCBI 
Gene model J090090C15  
Description NONE  
#
#

Overview

Focused view (chromosome 6: 30849988-30851187)

Genome position     
from initiation codon
004-006-A11         
006-110-E06         
AK060865            
AK072490            
J013052B02          
J013052B11          
J013052B13          
J013112O15          
J013112O19          
J023034F24          
J023128K16          
J023142H21          
J033065O05          
J033090B20          
J033091O13          
J033132C01          
J043010M18          
J065045C08          
J065059H05          
J065068B01          
J065110P05          
J065171F02          
J065179G19          
J065197N17          
J065204B05          
J065214H07          
J075192D20          
J090002P04          
J090014B15          
J090025P06          
J090050L11          
J090067F14          
J090068C19          
J100051J18          
J100055A07          
J100056J22          
J100059J12          
J100060B10          
J100061D02          
J100070B19          
J100072P13          
J100080H12          
J100086M23          
TSS from cDNA
TSS information
J090090C15                       5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J090090C15

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+30850900-88

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCACTGACA+3085080130850808-187-180
 OsREG510CACTGACA PPDB Motif  PLACE MotifTGAC 
REGAGGGCCCACCTGTCAG+3085081230850827-176-161
 OsREG475AGGGCCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GGGCCCAC        PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGCCCACC       PPDB MotifGCCCA  PLACE Motif 
 OsREG476   GCCCACCT      PPDB MotifGCCCA  PLACE Motif 
 OsREG514    CCCACCTG     PPDB MotifGCCCA  PLACE Motif 
 OsREG436     CCACCTGT    PPDB Motif  PLACE Motif 
 OsREG501      CACCTGTC   PPDB Motif  PLACE Motif 
 OsREG551        CCTGTCAG PPDB Motif  PLACE MotifTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.