version
PlantPromoterDB promoter information of J090095K16

Summary of Gene (J090095K16)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0430200        NCBI 
Gene model J090095K16  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 21118683-21119882)

Genome position     
from initiation codon
AK071740            
J023108J12          
TSS from cDNA
TSS information
J090095K16                       5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J090095K16

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+21119445-238

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCTCCCCCCTCC+2111942521119437-258-246
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCCACGCC+2111916721119174-516-509
 OsREG636TCCACGCC PPDB Motif  PLACE Motif 
REGACAGCCCATG+2111917921119188-504-495
 OsREG435ACAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG491 CAGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG467  AGCCCATG PPDB MotifGCCCA, CCATGG  PLACE Motif 
REGCAAGCCCACCAC+2111924121119252-442-431
 OsREG496CAAGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG427 AAGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG462  AGCCCACC   PPDB MotifGCCCA  PLACE Motif 
 OsREG599   GCCCACCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG527    CCCACCAC PPDB MotifGCCCA  PLACE Motif 
REGATCCGACGGCCCG+2111927021119282-413-401
 OsREG483ATCCGACG      PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG546 TCCGACGG     PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG584    GACGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG446     ACGGCCCG PPDB MotifACGGGC  PLACE Motif 
REGGGTCCACGGCC+2111929121119301-392-382
 OsREG570GGTCCACG    PPDB Motif  PLACE Motif 
 OsREG521   CCACGGCC PPDB Motif  PLACE Motif 
REGACCGGGCCCACCTGTC+2111930521119320-378-363
 OsREG441ACCGGGCC         PPDB Motif  PLACE Motif 
 OsREG543 CCGGGCCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG566  CGGGCCCA       PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG640   GGGCCCAC      PPDB MotifGCCCA  PLACE Motif 
 OsREG628    GGCCCACC     PPDB MotifGCCCA  PLACE Motif 
 OsREG476     GCCCACCT    PPDB MotifGCCCA  PLACE Motif 
 OsREG514      CCCACCTG   PPDB MotifGCCCA  PLACE Motif 
 OsREG436       CCACCTGT  PPDB Motif  PLACE Motif 
 OsREG501        CACCTGTC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.