version
PlantPromoterDB promoter information of J090097L07

Summary of Gene (J090097L07)

Organism Oryza sativa  
Chromosome 11  
Locus Os11g0525600        NCBI 
Gene model J090097L07  
Description NONE  
#
#

Overview

Focused view (chromosome 11: 20885450-20886649)

Genome position     
from initiation codon
AK068415            
AK098929            
J013020C01          
J013026M18          
J013034N20          
J013036D22          
J013044J09          
J013048C12          
J013049H24          
J013049J10          
J013050K16          
J013073F19          
J013075M11          
J013089M15          
J013093G06          
J013105C02          
J013109A11          
J013120G04          
J013130D10          
J013156L24          
J023022H22          
J023059E13          
J023065I09          
J023084F23          
J023117E15          
J033027B22          
J033111G01          
J033150C07          
J043021G23          
J053026C09          
J053027J02          
J053061N23          
J053086A13          
J053094C15          
J065123D13          
J075065C07          
J075094C03          
J075150B17          
J090054I22          
J090066J08          
J100025O15          
J100077N15          
TSS from cDNA
TSS information
J090097L07                       5'->3' (+)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J090097L07

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+20886220-230
TSS clone peakGclone+20886266-184

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCTTCTCC+2088629720886305-153-145
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGACGTGGC+2088613720886144-313-306
 OsREG585GACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 
REGGACAGGTGGGCCCCACCAC+2088619820886216-252-234
 OsREG501GACAGGTG            PPDB Motif  PLACE Motif 
 OsREG436 ACAGGTGG           PPDB Motif  PLACE Motif 
 OsREG514  CAGGTGGG          PPDB MotifGCCCA  PLACE Motif 
 OsREG476   AGGTGGGC         PPDB MotifGCCCA  PLACE Motif 
 OsREG628    GGTGGGCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG640     GTGGGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG647      TGGGCCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG641       GGGCCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG631        GGCCCCAC    PPDB Motif  PLACE Motif 
 OsREG612         GCCCCACC   PPDB Motif  PLACE Motif 
 OsREG527           CCCACCAC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.