version
PlantPromoterDB promoter information of J090099A09

Summary of Gene (J090099A09)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0523500        NCBI 
Gene model J090099A09  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 19959621-19958422)

Genome position     
from initiation codon
AK063159            
AK065061            
AY320036            
J013001J15          
J013041N20          
J013064I20          
J013114C13          
J023009O10          
J023026M10          
J023041F11          
J023109K12          
J023120M12          
J023148D20          
J033023D01          
J033025A16          
J033027P14          
J033045B18          
J033050N01          
J033057D08          
J033058O09          
J033060F20          
J033067F20          
J033073B09          
J033092D16          
J033103K19          
J033105F14          
J033111K02          
J033120K12          
J033126N03          
J043005J11          
J043010C12          
J043012F20          
J043016C06          
J043020O16          
J043040E03          
J065054B01          
J065057J23          
J065081F16          
J065098C10          
J065103A05          
J065149D16          
J065197I21          
J065203G07          
J065205M15          
J065214P09          
J075031G19          
J075033B22          
J075034A04          
J075042G24          
J075070A10          
J075104E04          
J075120H02          
J090004K16          
J090006K13          
J090009M21          
J090013D10          
J090016B11          
J090030I06          
J090037F16          
J090039N08          
J090039N15          
J090048L22          
J090049A13          
J090053E13          
J090057A19          
J090068F05          
J090070C23          
J090073G05          
J090080H19          
J090083C11          
J090084H01          
J090084O16          
J090085L23          
J090095E15          
J100018D14          
J100019C08          
J100021F15          
J100025M04          
J100031O13          
J100036D01          
J100038M05          
J100039I06          
J100042O17          
J100043C05          
J100050L12          
J100081E08          
J100083D17          
TSS from cDNA
TSS information
J090099A09                       5'->3' (-)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J090099A09

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-19959467-846

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTTCCT-1995949419959501-873-880
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCACCTGTC-1995962919959636-1008-1015
 OsREG501CACCTGTC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.