version
PlantPromoterDB promoter information of J090099P12

Summary of Gene (J090099P12)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0113100        NCBI 
Gene model J090099P12  
Description NONE  
#
#

Overview

Focused view (chromosome 8: 699339-700538)

Genome position     
from initiation codon
003-102-G01         
006-071-G11         
006-094-H01         
011-041-F02         
011-063-A09         
AB110164            
AF429947            
AK061391            
AK070120            
AK099353            
J013072L23          
J023031J20          
J023041C07          
J023068B05          
J023111H11          
J023114G22          
J023121E01          
J023121G16          
J023128D15          
J023142I22          
J033058M11          
J033092F23          
J033108M10          
J065085D10          
J065086I17          
J065137I08          
J065154L19          
J065179C12          
J065184K15          
J065195G07          
J075052K09          
J075093D08          
J075093L13          
J090005F03          
J090013F02          
J090026L07          
J090041P18          
J090081E12          
J090087F17          
J090091C17          
J100030P08          
J100055E21          
J100056N16          
J100061I23          
J100063L04          
J100065A14          
J100072A15          
J100080A04          
J100082K16          
J100088C06          
J100088L18          
TSS from cDNA
TSS information
J090099P12                       5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J090099P12

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+700252-87

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCTTTATA+700214700221-125-118
Y PatchCCCCCTCCTCTTCTTCCTCCTC+700230700251-109-88
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCAGGTGGGCCCCACC+699971699985-368-354
 OsREG514CAGGTGGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG476 AGGTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647    TGGGCCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG641     GGGCCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG631      GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG612       GCCCCACC PPDB Motif  PLACE Motif 
REGACGTGTCC+700000700007-339-332
 OsREG451ACGTGTCC PPDB MotifACGT  PLACE MotifACGTGKC 
REGAGCCGTTG+700049700056-290-283
 OsREG469AGCCGTTG PPDB MotifCCAACGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.