version
PlantPromoterDB promoter information of J100018H13

Summary of Gene (J100018H13)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0103100        NCBI 
Gene model J100018H13  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 163751-162552)

Genome position     
from initiation codon
AK103317            
J033125H15          
J065021L01          
J065029M01          
J065089F17          
J065112N04          
J065163L03          
J065175B04          
J065192E02          
J075046C20          
J075192A01          
J100067K20          
J100080N03          
TSS from cDNA
TSS information
J100018H13                       5'->3' (-)
Promoter sequence





 
006-040-F03         
006-046-E07         
006-048-H01         
006-051-D11         
006-073-E11         
006-080-H11         
006-083-D01         
006-085-F04         
006-091-D12         
006-101-A02         
006-104-F07         
006-107-D10         
006-117-D06         
AK061557            
AK104478            
AK104627            
AK104772            
AK119201            
J013055A01          
J013098L03          
J013102L10          
J013120K16          
J023003O11          
J023041K07          
J023079K07          
J023090N20          
J023108H02          
J033082M02          
J065141L15          
J090005I09          
J090030J04          
J090081B19          
J090081F21          
J100019G08          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J100018H13

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-162782-31

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGATGGGCTTG-162825162835-74-84
 OsREG608GGATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG466 GATGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG429  ATGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG496   TGGGCTTG PPDB MotifGCCCA  PLACE Motif 
REGGGGGCCCATGT-162844162854-93-103
 OsREG647GGGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG489 GGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG517  GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG437   GCCCATGT PPDB MotifGCCCA  PLACE Motif 
REGAAATGGGCTGATGGGC-162867162882-116-131
 OsREG422AAATGGGC         PPDB MotifGCCCA  PLACE Motif 
 OsREG432 AATGGGCT        PPDB MotifGCCCA  PLACE Motif 
 OsREG491  ATGGGCTG       PPDB MotifGCCCA  PLACE Motif 
 OsREG657   TGGGCTGA      PPDB MotifGCCCA  PLACE Motif 
 OsREG607        TGATGGGC PPDB MotifGCCCA  PLACE Motif 
REGGGGCCGCA-162902162909-151-158
 OsREG643GGGCCGCA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+163696AK119201, J023079K07, AK119201, 006-101-A02, J090081B19, J090081F21, J013055A01, 006-107-D10, 006-085-F04, AK061557, 006-046-E07, J090005I09, J090030J04, 006-083-D01, J023003O11, J013120K16, AK104772, 006-048-H01, AK104627, 006-040-F03, J013098L03, 006-073-E11, J023108H02, 006-051-D11, J023041K07, J033082M02, 006-104-F07, J100019G08, J023090N20, J013102L10, 006-117-D06, J065141L15, AK104478, J023103J15, AK104195, J013027B22, J023055G17
TSS clone peakGclone+163708AK119201, J023079K07, AK119201, 006-101-A02, J090081B19, J090081F21, J013055A01, 006-107-D10, 006-085-F04, AK061557, 006-046-E07, J090005I09, J090030J04, 006-083-D01, J023003O11, J013120K16, AK104772, 006-048-H01, AK104627, 006-040-F03, J013098L03, 006-073-E11, J023108H02, 006-051-D11, J023041K07, J033082M02, 006-104-F07, J100019G08, J023090N20, J013102L10, 006-117-D06, J065141L15, AK104478, J023103J15, AK104195, J013027B22, J023055G17
TSS cloneAclone+163750AK119201, J023079K07, AK119201, 006-101-A02, J090081B19, J090081F21, J013055A01, 006-107-D10, 006-085-F04, AK061557, 006-046-E07, J090005I09, J090030J04, 006-083-D01, J023003O11, J013120K16, AK104772, 006-048-H01, AK104627, 006-040-F03, J013098L03, 006-073-E11, J023108H02, 006-051-D11, J023041K07, J033082M02, 006-104-F07, J100019G08, J023090N20, J013102L10, 006-117-D06, J065141L15, AK104478, J023103J15, AK104195, J013027B22, J023055G17

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGGTGTGTG+163644163651006-040-F03, 006-046-E07, 006-048-H01, 006-051-D11, 006-073-E11, 006-083-D01, 006-085-F04, 006-101-A02, 006-104-F07, 006-107-D10, 006-117-D06, AK061557, AK104195, AK104478, AK104627, AK104772, AK119201, J013027B22, J013055A01, J013098L03, J013102L10, J013120K16, J023003O11, J023041K07, J023055G17, J023079K07, J023090N20, J023103J15, J023108H02, J033082M02, J065141L15, J090005I09, J090030J04, J090081B19, J090081F21, J100019G08
 OsREG499GGTGTGTG PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.