version
PlantPromoterDB promoter information of J100018J19

Summary of Gene (J100018J19)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0125300        NCBI 
Gene model J100018J19  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 1326071-1327270)

Genome position     
from initiation codon
006-047-E06         
006-088-F09         
006-106-F10         
AB025926            
AK061564            
AK061953            
AK101060            
J013072O21          
J023097A08          
J023133F03          
J033022C21          
J033073C21          
J033116O09          
J033120E01          
J065088M19          
J065135O04          
J080304J03          
J090001K14          
J090038D04          
J090045G09          
J090076E12          
J090077D21          
J100029M12          
J100049D07          
J100067G21          
J100090D05          
TSS from cDNA
TSS information
J100018J19                       5'->3' (+)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J100018J19

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+1326932-139

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxGTATATAAACC+13268901326900-181-171
Y PatchCCCCCCCCCCC+13268991326909-172-162
Y PatchCCTCCCCTCTC+13269111326921-160-150
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGCACCGCACCGCAC+13267631326777-308-294
 OsREG554CGCACCGCACCGC   PPDB Motif  PLACE Motif 
 OsREG500  CACCGCACCGCAC PPDB Motif  PLACE Motif 
REGCTCGCGCGTGCGTGGGCCCCACC+13268521326874-219-197
 OsREG558CTCGCGCG                PPDB MotifACGCGC  PLACE Motif 
 OsREG555    CGCGTGCG            PPDB Motif  PLACE Motif 
 OsREG602         GCGTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG571          CGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640           GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647            TGGGCCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG641             GGGCCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG631              GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG612               GCCCCACC PPDB Motif  PLACE Motif 
REGGCCCCCACGCGCGGGT+13268761326891-195-180
 OsREG613GCCCCCAC         PPDB Motif  PLACE Motif 
 OsREG536 CCCCCACG        PPDB Motif  PLACE Motif 
 OsREG530   CCCACGCG      PPDB MotifGCCCA  PLACE Motif 
 OsREG439        GCGCGGGT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.