version
PlantPromoterDB promoter information of J100027D02

Summary of Gene (J100027D02)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0462500        NCBI 
Gene model J100027D02  
Description NONE  
#
#

Overview

Focused view (chromosome 4: 23501144-23502343)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
J100027D02                       5'->3' (+)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J100027D02

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+23502580-814
TSS clone peakGclone+23502987-407

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCCCC+2350258223502589-812-805
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCCAACGG+2350231423502321-1080-1073
 OsREG548TCCAACGG PPDB MotifCCAACGG  PLACE Motif 
REGGGCCGTGGGACCCAC+2350236823502382-1026-1012
 OsREG521GGCCGTGG        PPDB Motif  PLACE Motif 
 OsREG650    GTGGGACC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG648     TGGGACCC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG637      GGGACCCA  PPDB MotifGGGACCC  PLACE Motif 
 OsREG622       GGACCCAC PPDB MotifGGGACCC  PLACE Motif 
REGTGTGGGCCCCACC+2350240023502412-994-982
 OsREG627TGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647  TGGGCCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG641   GGGCCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG631    GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG612     GCCCCACC PPDB Motif  PLACE Motif 
REGCCCCCGCG+2350242723502434-967-960
 OsREG537CCCCCGCG PPDB Motif  PLACE Motif 
REGGTGGTGGGGCCGTG+2350246723502480-927-914
 OsREG527GTGGTGGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG612  GGTGGGGC     PPDB Motif  PLACE Motif 
 OsREG631   GTGGGGCC    PPDB Motif  PLACE Motif 
 OsREG504      GGGCCGTG PPDB MotifGCCCA  PLACE Motif 
REGGCCACGTG+2350248323502490-911-904
 OsREG507GCCACGTG PPDB MotifACGT  PLACE MotifACGTGKC 
REGCCCCCGCG+2350275823502765-636-629
 OsREG537CCCCCGCG PPDB Motif  PLACE Motif 
REGGGCCGTTT+2350277423502781-620-613
 OsREG420GGCCGTTT PPDB MotifAAACG(C/G)  PLACE Motif 
REGCGGGTGGG+2350288423502891-510-503
 OsREG528CGGGTGGG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.