version
PlantPromoterDB promoter information of J100029D05

Summary of Gene (J100029D05)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0115200        NCBI 
Gene model J100029D05  
Description NONE  
#
#

Overview

Focused view (chromosome 6: 857968-856769)

Genome position     
from initiation codon
J100048P05          
TSS from cDNA
TSS information
J100029D05                       5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J100029D05

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-856989-21

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCCTCCTCCT-8569408569502818
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCACACACC-857055857062-87-94
 OsREG499CACACACC PPDB Motif  PLACE Motif 
REGAGCCGTCC-857083857090-115-122
 OsREG468AGCCGTCC PPDB Motif  PLACE Motif 
REGCCACTGACATGTGGGCCCCACG-857092857113-124-145
 OsREG522CCACTGAC               PPDB Motif  PLACE MotifTGAC 
 OsREG510 CACTGACA              PPDB Motif  PLACE MotifTGAC 
 OsREG627         TGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640          GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647           TGGGCCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG641            GGGCCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG631             GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG572              GCCCCACG PPDB Motif  PLACE Motif 
REGGGCCGAGA-857124857131-156-163
 OsREG635GGCCGAGA PPDB Motif  PLACE Motif 
REGTGTGGGGCCCACAC-857136857149-168-181
 OsREG611TGTGGGGC       PPDB Motif  PLACE Motif 
 OsREG631 GTGGGGCC      PPDB Motif  PLACE Motif 
 OsREG641  TGGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647   GGGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG640    GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG627     GGCCCACA  PPDB MotifGCCCA  PLACE Motif 
 OsREG598      GCCCACAC PPDB MotifGCCCA  PLACE Motif 
REGATTTGGGC-857201857208-233-240
 OsREG493ATTTGGGC PPDB MotifGCCCA  PLACE Motif 
REGTGTGGGCCCG-857244857253-276-285
 OsREG627TGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GTGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG566  TGGGCCCG PPDB MotifGCCCA, ACGGGC  PLACE Motif 
REGGGGACCCA-857273857280-305-312
 OsREG637GGGACCCA PPDB MotifGGGACCC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.