PlantPromoterDB promoter information of J100029I04

Summary of Gene (J100029I04)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0819900        NCBI 
Gene model J100029I04  
Description NONE  


Focused view (chromosome 3: 35256839-35258038)

Genome position     
from initiation codon
TSS from cDNA
TSS information
J100029I04                       5'->3' (+)
Promoter sequence

TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence


Promoter Summary of J100029I04

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
TSS clone peakGclone+35257826AK112029, 006-058-B05, AK112029, AK111912, J100070N08, AY576526, AY579410, J075041G24

Core promoter information

TypeSequenceGenome positionGene model
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCCCCTCTC+3525783835257847006-058-B05, AK111912, AK112029, AY576526, AY579410, J075041G24, J100070N08
Y PatchTCTCCTCCCCTCCCCC+3525785935257874006-058-B05, AK111912, AK112029, AY576526, AY579410, J075041G24, J100070N08

REG information

TypeSequenceAnnotationGenome positionGene model
REGGGGCCAGACAGCCCACAC+3525762235257639006-058-B05, AK111912, AK112029, AY576526, AY579410, J075041G24, J100070N08
 OsREG638GGGCCAGA           PPDB MotifGCCCA  PLACE Motif 
 OsREG435       ACAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG461         AGCCCACA  PPDB MotifGCCCA  PLACE Motif 
 OsREG598          GCCCACAC PPDB MotifGCCCA  PLACE Motif 
REGACTGGGCCCT+3525766335257672006-058-B05, AK111912, AK112029, AY576526, AY579410, J075041G24, J100070N08
REGTAATGGGCCTGAATGGGCCGGGCC+3525767835257701006-058-B05, AK111912, AK112029, AY576526, AY579410, J075041G24, J100070N08
 OsREG610TAATGGGC                 PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT               PPDB MotifGCCCA  PLACE Motif 
 OsREG513   TGGGCCTG              PPDB MotifGCCCA  PLACE Motif 
 OsREG646    GGGCCTGA             PPDB MotifGCCCA  PLACE Motif 
 OsREG490            ATGGGCCG     PPDB MotifGCCCA  PLACE Motif 
 OsREG542             TGGGCCGG    PPDB MotifGCCCA  PLACE Motif 
 OsREG538              GGGCCGGG   PPDB MotifGCCCA  PLACE Motif 
 OsREG614               GGCCGGGC  PPDB Motif  PLACE Motif 
 OsREG616                GCCGGGCC PPDB Motif  PLACE Motif 
REGCGCACGCGCGCGAC+3525771735257730006-058-B05, AK111912, AK112029, AY576526, AY579410, J075041G24, J100070N08
 OsREG555CGCACGCG       PPDB Motif  PLACE Motif 
 OsREG617     GCGCGCGA  PPDB Motif  PLACE Motif 

Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.