version
PlantPromoterDB promoter information of J100029I04

Summary of Gene (J100029I04)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0819900        NCBI 
Gene model J100029I04  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 35257689-35258888)

Genome position     
from initiation codon
006-058-B05         
006-093-H04         
AK111912            
AK112029            
AY576526            
AY579410            
J013089F15          
J033126H16          
J065105B21          
J075041G24          
J075142L06          
J075145K15          
J100025G07          
J100030A22          
J100031F11          
J100043N05          
J100049C23          
J100070N08          
TSS from cDNA
TSS information
J100029I04                       5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J100029I04

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone+35257826AK112029, 006-058-B05, AK112029, AK111912, J100070N08, AY576526, AY579410, J075041G24

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCCCCTCTC+3525783835257847006-058-B05, AK111912, AK112029, AY576526, AY579410, J075041G24, J100070N08
Y PatchTCTCCTCCCCTCCCCC+3525785935257874006-058-B05, AK111912, AK112029, AY576526, AY579410, J075041G24, J100070N08
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGGGCCTGAATGGGCCGGGCC+3525768235257701006-058-B05, AK111912, AK112029, AY576526, AY579410, J075041G24, J100070N08
 OsREG646GGGCCTGA             PPDB MotifGCCCA  PLACE Motif 
 OsREG431       AATGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG490        ATGGGCCG     PPDB MotifGCCCA  PLACE Motif 
 OsREG542         TGGGCCGG    PPDB MotifGCCCA  PLACE Motif 
 OsREG538          GGGCCGGG   PPDB MotifGCCCA  PLACE Motif 
 OsREG614           GGCCGGGC  PPDB Motif  PLACE Motif 
 OsREG616            GCCGGGCC PPDB Motif  PLACE Motif 
REGCGCACGCGCGCGAC+3525771735257730006-058-B05, AK111912, AK112029, AY576526, AY579410, J075041G24, J100070N08
 OsREG555CGCACGCG       PPDB Motif  PLACE Motif 
 OsREG617     GCGCGCGA  PPDB Motif  PLACE Motif 
 OsREG557      CGCGCGAC PPDB MotifACGCGC  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.