version
PlantPromoterDB promoter information of J100032E17

Summary of Gene (J100032E17)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0219800        NCBI 
Gene model J100032E17  
Description NONE  
#
#

Overview

Focused view (chromosome 6: 6176258-6175059)

Genome position     
from initiation codon
011-090-C04         
AK072030            
AK100405            
J065063P03          
J100081I18          
TSS from cDNA
TSS information
J100032E17                       5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J100032E17

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-6175330-72

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCCTCTT-61753616175369-103-111
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTGGCCCATGGAGCCCATCAGCCCAAAC-61753886175415-130-157
 OsREG577CTGGCCCA                     PPDB MotifGCCCA  PLACE Motif 
 OsREG488 TGGCCCAT                    PPDB MotifGCCCA  PLACE Motif 
 OsREG517  GGCCCATG                   PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG525   GCCCATGG                  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG466           AGCCCATC          PPDB MotifGCCCA  PLACE Motif 
 OsREG607            GCCCATCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG657                 TCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG511                  CAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG457                   AGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG593                    GCCCAAAC PPDB MotifGCCCA  PLACE Motif 
REGGGCTGGGCT-61754366175444-178-186
 OsREG603GGCTGGGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG464 GCTGGGCT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.