version
PlantPromoterDB promoter information of J100032M21

Summary of Gene (J100032M21)

Organism Oryza sativa  
Chromosome 9  
Locus Os09g0468900        NCBI 
Gene model J100032M21  
Description NONE  
#
#

Overview

Focused view (chromosome 9: 18489578-18490777)

Genome position     
from initiation codon
AK120990            
J013123P13          
J023013I09          
J023023G08          
J023043E08          
J033124D24          
J065047I07          
J065093C16          
J080305M10          
J090088O03          
TSS from cDNA
TSS information
J100032M21                       5'->3' (+)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J100032M21

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+18489616-962

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCCTCTTCCTCCTCT+1848961718489632-961-946
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCGGGCC+1848946718489474-1111-1104
 OsREG539CCCGGGCC PPDB Motif  PLACE Motif 
REGGCTGGGCCGTCC+1848948718489498-1091-1080
 OsREG620GCTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG565 CTGGGCCG    PPDB MotifGCCCA  PLACE Motif 
 OsREG445  TGGGCCGT   PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG584   GGGCCGTC  PPDB MotifGCCCA  PLACE Motif 
 OsREG624    GGCCGTCC PPDB Motif  PLACE Motif 
REGTCGGCCCATCAGGCCCACGT+1848951818489537-1060-1041
 OsREG658TCGGCCCA             PPDB MotifGCCCA  PLACE Motif 
 OsREG490 CGGCCCAT            PPDB MotifGCCCA  PLACE Motif 
 OsREG590  GGCCCATC           PPDB MotifGCCCA  PLACE Motif 
 OsREG607   GCCCATCA          PPDB MotifGCCCA  PLACE Motif 
 OsREG646        TCAGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG513         CAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG472          AGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG571           GGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG449            GCCCACGT PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.