version
PlantPromoterDB promoter information of J100032N19

Summary of Gene (J100032N19)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0218400        NCBI 
Gene model J100032N19  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 6266538-6265339)

Genome position     
from initiation codon
AK069202            
AK099306            
AY342321            
J013090A14          
J023009G17          
J023012F17          
J023014H06          
J023027B12          
J023037C17          
J023037D22          
J023041A19          
J023045O21          
J023052F11          
J023056A17          
J023066K08          
J023074G23          
J023085D06          
J023099O16          
J023102E03          
J023108C20          
J023145P06          
J033028N13          
J033051K17          
J033084E15          
J033085F07          
J033085P05          
J033092H22          
J033092N04          
J033105F11          
J090051F12          
J100035P20          
J100075A14          
J100075C11          
J100079A19          
J100080P11          
TSS from cDNA
TSS information
J100032N19                       5'->3' (-)
Promoter sequence












 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J100032N19

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-6265633-95
TSS clone peakAclone-6265629-91

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCTCTATATATAGC-62656556265668-117-130
Y PatchCTCCCTCTCT-62656646265673-126-135
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCACTCC-62656706265677-132-139
 OsREG532CCCACTCC PPDB MotifGCCCA  PLACE Motif 
REGGCCACGTGGC-62657316265740-193-202
 OsREG507GCCACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 
REGGTGGGTCCCACC-62657446265755-206-217
 OsREG622GTGGGTCC     PPDB MotifGGGACCC  PLACE Motif 
 OsREG637 TGGGTCCC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG648  GGGTCCCA   PPDB MotifGGGACCC  PLACE Motif 
 OsREG650   GGTCCCAC  PPDB MotifGGGACCC  PLACE Motif 
 OsREG651    GTCCCACC PPDB MotifGGGACCC  PLACE Motif 
REGGGGAAAGC-62658006265807-262-269
 OsREG621GGGAAAGC PPDB Motif  PLACE Motif 
REGTCCGGCCCGTGGGCCGC-62658096265825-271-287
 OsREG644TCCGGCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG531     CCCGTGGG     PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG547      CCGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG571       CGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG564        GTGGGCCG  PPDB MotifGCCCA  PLACE Motif 
 OsREG618         TGGGCCGC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.