version
PlantPromoterDB promoter information of J100035H09

Summary of Gene (J100035H09)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0674400        NCBI 
Gene model J100035H09  
Description NONE  
#
#

Overview

Focused view (chromosome 4: 34822710-34823909)

Genome position     
from initiation codon
015-042-B08         
AK102124            
J013129O22          
J023022I24          
J023037B18          
J023062I07          
J023120A15          
J023123P20          
J033067O19          
J033068P09          
J033084O13          
J033107G22          
J033116G12          
J033133F03          
J033143B20          
J043006G12          
J043027M18          
J043034H17          
J090091E20          
J100037J04          
J100047J24          
J100059G06          
J100066O12          
J100074G23          
J100077M12          
TSS from cDNA
TSS information
J100035H09                       5'->3' (+)
Promoter sequence









 
J065104O14          
J065118J19          
J065167I12          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence






 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J100035H09

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+34823516-194

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCCCCCCCCCCCCCC+3482348934823504-221-206
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGCGTCTC+3482323734823244-473-466
 OsREG560CGCGTCTC PPDB Motif  PLACE Motif 
REGTATTGGGCCAG+3482325134823261-459-449
 OsREG596TATTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG492 ATTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG659  TTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG577   TGGGCCAG PPDB MotifGCCCA  PLACE Motif 
REGGCGGCCCATCT+3482327734823287-433-423
 OsREG618GCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490 CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590  GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG456   GCCCATCT PPDB MotifGCCCA  PLACE Motif 
REGCGCGTCGC+3482332534823332-385-378
 OsREG559CGCGTCGC PPDB Motif  PLACE MotifCGACG 
REGCGACACGTG+3482335734823365-353-345
 OsREG452CGACACGT  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG509 GACACGTG PPDB MotifACGT  PLACE MotifACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone-34823154J065167I12, J065104O14, J065118J19, J065167I12

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTCTCGGCCCATGG-3482321134823223J065104O14, J065118J19, J065167I12
 OsREG635TCTCGGCC      PPDB Motif  PLACE Motif 
 OsREG575 CTCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG658  TCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490   CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG517    GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG525     GCCCATGG PPDB MotifGCCCA, CCATGG  PLACE Motif 
REGGAGACGCG-3482323734823244J065104O14, J065118J19, J065167I12
 OsREG560GAGACGCG PPDB Motif  PLACE Motif 
REGCTGGCCCAATA-3482325134823261J065104O14, J065118J19, J065167I12
 OsREG577CTGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG659 TGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG492  GGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG596   GCCCAATA PPDB MotifGCCCA  PLACE Motif 
REGAGATGGGCCGC-3482327734823287J065104O14, J065118J19, J065167I12
 OsREG456AGATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG  PPDB MotifGCCCA  PLACE Motif 
 OsREG618   TGGGCCGC PPDB MotifGCCCA  PLACE Motif 
REGGCGACGCG-3482332534823332J065104O14, J065118J19, J065167I12
 OsREG559GCGACGCG PPDB Motif  PLACE MotifCGACG 
REGCACGTGTCG-3482335734823365J065104O14, J065118J19, J065167I12
 OsREG509CACGTGTC  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG452 ACGTGTCG PPDB MotifACGT  PLACE MotifACGTGKC 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.