PlantPromoterDB promoter information of J100037D13
Summary of Gene (J100037D13)
|
Overview
|
Focused view (chromosome 2: 27927813-27929012)
|
Genome position
from initiation codon TSS from cDNA TSS information J100037D13 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence |
|
|
|
Promoter Summary of J100037D13
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone peak | A | clone | + | 27931256 | -57 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | CCTTTATA | + | 27931222 | 27931229 | -91 | -84 |
| Y Patch | CTCCTCTCTCTC | + | 27931238 | 27931249 | -75 | -64 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | CTGGCCCACCAGGGCCCACGC | + | 27931119 | 27931139 | -194 | -174 | |||
| OsREG577 | CTGGCCCA | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG654 | TGGCCCAC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG628 | GGCCCACC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG599 | GCCCACCA | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG475 | AGGGCCCA | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG640 | GGGCCCAC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG571 | GGCCCACG | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG602 | GCCCACGC | PPDB Motif | GCCCA | PLACE Motif | |||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||