version
PlantPromoterDB promoter information of J100040E12

Summary of Gene (J100040E12)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0156500        NCBI 
Gene model J100040E12  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 3017398-3018597)

Genome position     
from initiation codon
011-075-F02         
012-077-G10         
AK103466            
J013088H17          
J013135G21          
J033050E10          
J033050J01          
J033129N23          
J065085L16          
J065101B19          
J065167N03          
J090009O21          
J090049D11          
J100017F23          
J100055O18          
J100061K08          
J100072M05          
J100077B08          
J100086G03          
TSS from cDNA
TSS information
J100040E12                       5'->3' (+)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J100040E12

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+3018100-298

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCTCTCTCTCTCCC+30180513018067-347-331
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATCGGACGGGCCGCA+30178093017823-589-575
 OsREG484ATCGGACG        PPDB Motif  PLACE Motif 
 OsREG545 TCGGACGG       PPDB Motif  PLACE Motif 
 OsREG643       GGGCCGCA PPDB MotifGCCCA  PLACE Motif 
REGCCCACACG+30178443017851-554-547
 OsREG526CCCACACG PPDB MotifGCCCA  PLACE Motif 
REGCCACGGCC+30178663017873-532-525
 OsREG521CCACGGCC PPDB Motif  PLACE Motif 
REGCGGGCCCACGTG+30178783017889-520-509
 OsREG566CGGGCCCA     PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG640 GGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG571  GGCCCACG   PPDB MotifGCCCA  PLACE Motif 
 OsREG449   GCCCACGT  PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG508    CCCACGTG PPDB MotifACGT  PLACE Motif 
REGCGCGGGGGGGTGGGCCCCACAC+30179363017957-462-441
 OsREG537CGCGGGGG               PPDB Motif  PLACE Motif 
 OsREG600       GGGTGGGC        PPDB MotifGCCCA  PLACE Motif 
 OsREG628        GGTGGGCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG640         GTGGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG647          TGGGCCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG641           GGGCCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG631            GGCCCCAC   PPDB Motif  PLACE Motif 
 OsREG611             GCCCCACA  PPDB Motif  PLACE Motif 
 OsREG535              CCCCACAC PPDB Motif  PLACE Motif 
REGGGCCGTCCG+30179733017981-425-417
 OsREG624GGCCGTCC  PPDB Motif  PLACE Motif 
 OsREG562 GCCGTCCG PPDB Motif  PLACE Motif 
REGGATCGGACGG+30179863017995-412-403
 OsREG589GATCGGAC   PPDB Motif  PLACE Motif 
 OsREG484 ATCGGACG  PPDB Motif  PLACE Motif 
 OsREG545  TCGGACGG PPDB Motif  PLACE Motif 
REGACAGGTGG+30180113018018-387-380
 OsREG436ACAGGTGG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.