version
PlantPromoterDB promoter information of J100043F05

Summary of Gene (J100043F05)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0606800        NCBI 
Gene model J100043F05  
Description NONE  
#
#

Overview

Focused view (chromosome 4: 31079760-31080959)

Genome position     
from initiation codon
009-159-H11         
AK072824            
J023060F19          
J023104O11          
J023134C17          
J033070J06          
J033119D03          
J100050A01          
TSS from cDNA
TSS information
J100043F05                       5'->3' (+)
Promoter sequence







 
AK103790            
J033145L05          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J100043F05

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+31080695-65

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTGGGGCCCACAAGTCAGTGG+3108040931080429-351-331
 OsREG631GTGGGGCC              PPDB Motif  PLACE Motif 
 OsREG641 TGGGGCCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG647  GGGGCCCA            PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GGGCCCAC           PPDB MotifGCCCA  PLACE Motif 
 OsREG627    GGCCCACA          PPDB MotifGCCCA  PLACE Motif 
 OsREG597     GCCCACAA         PPDB MotifGCCCA  PLACE Motif 
 OsREG522             GTCAGTGG PPDB Motif  PLACE MotifTGAC 
REGAGATGGGCCCACATGTCAGTG+3108050431080524-256-236
 OsREG456AGATGGGC              PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG489  ATGGGCCC            PPDB MotifGCCCA  PLACE Motif 
 OsREG640    GGGCCCAC          PPDB MotifGCCCA  PLACE Motif 
 OsREG627     GGCCCACA         PPDB MotifGCCCA  PLACE Motif 
 OsREG510             TGTCAGTG PPDB Motif  PLACE MotifTGAC 
REGGGTCCCACC+3108056031080568-200-192
 OsREG650GGTCCCAC  PPDB MotifGGGACCC  PLACE Motif 
 OsREG651 GTCCCACC PPDB MotifGGGACCC  PLACE Motif 
REGGTCAGTGG+3108057031080577-190-183
 OsREG522GTCAGTGG PPDB Motif  PLACE MotifTGAC 
REGGATCGGACGG+3108062831080637-132-123
 OsREG589GATCGGAC   PPDB Motif  PLACE Motif 
 OsREG484 ATCGGACG  PPDB Motif  PLACE Motif 
 OsREG545  TCGGACGG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.