version
PlantPromoterDB promoter information of J100043J09

Summary of Gene (J100043J09)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0921600        NCBI 
Gene model J100043J09  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 41995793-41996992)

Genome position     
from initiation codon
AK071344            
J013039J22          
J013109E03          
J023081J12          
J023091E24          
J033022A01          
J033074C13          
J065199E03          
J075172O04          
J090007G18          
J090052B17          
J090074H01          
J100059J05          
TSS from cDNA
TSS information
J100043J09                       5'->3' (+)
Promoter sequence










 
AK105517            
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J100043J09

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+41996657-136
TSS clone peakGclone+41996664-129

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCCCCCCCCCCC+4199661141996623-182-170
Y PatchCCTCCTCCTCCTCCTCC+4199664741996663-146-130
Y PatchTCCTCCTCTCTCTCCCC+4199666541996681-128-112
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCGCGCGCGAC+4199638741996397-406-396
 OsREG617TCGCGCGCGA  PPDB Motif  PLACE Motif 
 OsREG557   CGCGCGAC PPDB MotifACGCGC  PLACE Motif 
REGTCGCGCGC+4199640541996412-388-381
 OsREG617TCGCGCGC PPDB Motif  PLACE Motif 
REGAGATGGGCT+4199645841996466-335-327
 OsREG456AGATGGGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG466 GATGGGCT PPDB MotifGCCCA  PLACE Motif 
REGGGTGGGCTGGGCCGGG+4199647741996492-316-301
 OsREG462GGTGGGCT         PPDB MotifGCCCA  PLACE Motif 
 OsREG523  TGGGCTGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG533   GGGCTGGG      PPDB MotifGCCCA  PLACE Motif 
 OsREG603    GGCTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG620     GCTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG565      CTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542       TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG538        GGGCCGGG PPDB MotifGCCCA  PLACE Motif 
REGCACTGACAGGTGGGGCCGGA+4199654641996565-247-228
 OsREG510CACTGACA             PPDB Motif  PLACE MotifTGAC 
 OsREG453 ACTGACAG            PPDB Motif  PLACE MotifTGAC 
 OsREG551  CTGACAGG           PPDB Motif  PLACE MotifTGAC 
 OsREG501    GACAGGTG         PPDB Motif  PLACE Motif 
 OsREG436     ACAGGTGG        PPDB Motif  PLACE Motif 
 OsREG514      CAGGTGGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG612        GGTGGGGC     PPDB Motif  PLACE Motif 
 OsREG631         GTGGGGCC    PPDB Motif  PLACE Motif 
 OsREG644            GGGCCGGA PPDB MotifGCCCA  PLACE Motif 
REGCCCGGGCCCACGTGTC+4199657041996585-223-208
 OsREG539CCCGGGCC         PPDB Motif  PLACE Motif 
 OsREG543 CCGGGCCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG566  CGGGCCCA       PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG640   GGGCCCAC      PPDB MotifGCCCA  PLACE Motif 
 OsREG571    GGCCCACG     PPDB MotifGCCCA  PLACE Motif 
 OsREG449     GCCCACGT    PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG508      CCCACGTG   PPDB MotifACGT  PLACE Motif 
 OsREG434       CCACGTGT  PPDB MotifACGT  PLACE Motif 
 OsREG509        CACGTGTC PPDB MotifACGT  PLACE MotifACGTGKC 
REGGCGGTGCG+4199660141996608-192-185
 OsREG554GCGGTGCG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.