version
PlantPromoterDB promoter information of J100044I09

Summary of Gene (J100044I09)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0836800        NCBI 
Gene model J100044I09  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 37629983-37628784)

Genome position     
from initiation codon
006-021-C09         
006-091-F04         
014-013-D08         
015-018-F10         
015-058-H03         
AK061720            
AK066629            
AK098958            
AK106145            
AK119783            
J013063N02          
J013071A10          
J013124C08          
J023055J07          
J023081H15          
J023082D01          
J023091F07          
J023091L13          
J023104G05          
J023110M16          
J023120F18          
J023128O11          
J023140B11          
J033023B15          
J033025E14          
J033027J21          
J033041F19          
J033044L10          
J033052M08          
J033084P07          
J033086P11          
J033090I20          
J033093D17          
J033099C04          
J033108M19          
J033124O20          
J033145D24          
J033145O09          
J043016F03          
J043037C06          
J053095L22          
J053100E09          
J065023G19          
J065197D03          
J090003E23          
J090012P18          
J090019E14          
J090021B01          
J090022J10          
J090045L06          
J090050J02          
J090065F15          
J100018A06          
J100022K07          
J100036H01          
J100057M17          
J100058O04          
J100079C21          
J100079G13          
TSS from cDNA
TSS information
J100044I09                       5'->3' (-)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J100044I09

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-37629045-62
TSS clone peakGclone-37629044-61

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCCCCC-3762899737629004-14-21
Y PatchCCTCCTCCCCC-3762900637629016-23-33
Y PatchCCTCCTCC-3762901837629025-35-42
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCCACGCC-3762908537629092-102-109
 OsREG636TCCACGCC PPDB Motif  PLACE Motif 
REGATCCAACGG-3762910137629109-118-126
 OsREG481ATCCAACG  PPDB MotifCCAACGG  PLACE Motif 
 OsREG548 TCCAACGG PPDB MotifCCAACGG  PLACE Motif 
REGCCCACCTG-3762912837629135-145-152
 OsREG514CCCACCTG PPDB MotifGCCCA  PLACE Motif 
REGATCCAACG-3762920137629208-218-225
 OsREG481ATCCAACG PPDB MotifCCAACGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.