version
PlantPromoterDB promoter information of J100049C22

Summary of Gene (J100049C22)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0791800        NCBI 
Gene model J100049C22  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 33787005-33785806)

Genome position     
from initiation codon
013-037-A12         
AB079798            
AK067703            
AK120251            
J013045G10          
J023102B18          
J065020J23          
J065127I21          
J065151E11          
J075076B05          
J075116C15          
J075136A07          
J100029G21          
J100030K01          
J100041J02          
J100057G17          
J100086L12          
TSS from cDNA
TSS information
J100049C22                       5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J100049C22

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakTclone-33786185-180

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCCTCTCTCTC-3378613933786152-134-147
Y PatchCTCCCTCTCCTCCTC-3378617233786186-167-181
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGTTGGGCCCC-3378625733786267-252-262
 OsREG595GGTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG626 GTTGGGCC   PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG639  TTGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG647   TGGGCCCC PPDB MotifGCCCA  PLACE Motif 
REGAGCCGTCC-3378629533786302-290-297
 OsREG468AGCCGTCC PPDB Motif  PLACE Motif 
REGCACGTGGGACCCA-3378633333786345-328-340
 OsREG508CACGTGGG      PPDB MotifACGT  PLACE Motif 
 OsREG650   GTGGGACC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG648    TGGGACCC  PPDB MotifGGGACCC  PLACE Motif 
 OsREG637     GGGACCCA PPDB MotifGGGACCC  PLACE Motif 
REGCAGGTGGGCCAT-3378635033786361-345-356
 OsREG514CAGGTGGG     PPDB MotifGCCCA  PLACE Motif 
 OsREG476 AGGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG654   GTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG487    TGGGCCAT PPDB MotifGCCCA  PLACE Motif 
REGCGTGGACCCAC-3378643833786448-433-443
 OsREG570CGTGGACC    PPDB Motif  PLACE Motif 
 OsREG622   GGACCCAC PPDB MotifGGGACCC  PLACE Motif 
REGGACAGGTGGGCCCATGG-3378646533786481-460-476
 OsREG501GACAGGTG          PPDB Motif  PLACE Motif 
 OsREG436 ACAGGTGG         PPDB Motif  PLACE Motif 
 OsREG514  CAGGTGGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG476   AGGTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG628    GGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640     GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG489       GGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG517        GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG525         GCCCATGG PPDB MotifGCCCA, CCATGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.