version
PlantPromoterDB promoter information of J100053H24

Summary of Gene (J100053H24)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0855600        NCBI 
Gene model J100053H24  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 36924812-36926011)

Genome position     
from initiation codon
006-029-G09         
006-033-E02         
006-069-G07         
006-083-A02         
006-098-H04         
009-054-C04         
AK060030            
AK061467            
AK067858            
AK106030            
J013123A10          
J065001I24          
J065015N21          
J065016H07          
J065040A05          
J065040F01          
J065066G17          
J065077I09          
J065099M22          
J065135B13          
J065144H19          
J065146I03          
J065169E02          
J065177D21          
J065189L20          
J065207H13          
J065210D24          
J065212I03          
J075007E21          
J075013H07          
J075023K06          
J075031D23          
J075038K09          
J075084C08          
J075098K20          
J090028E04          
J090031E20          
J090042F06          
J090049L05          
J090086G03          
J090096J04          
J100035O03          
J100056L17          
J100058K06          
J100059G09          
J100081C15          
Os03g0855500        
TSS from cDNA
TSS information
J100053H24                       5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J100053H24

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+36925742-70

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCTCAGCT+3692550236925509-310-303
 OsREG470GCTCAGCT PPDB Motif  PLACE Motif 
REGTAATGGGCTTT+3692557236925582-240-230
 OsREG610TAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG432 AATGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG429  ATGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG421   TGGGCTTT PPDB MotifGCCCA  PLACE Motif 
REGTCTGGGCCGTA+3692561636925626-196-186
 OsREG629TCTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG565 CTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG445  TGGGCCGT  PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG645   GGGCCGTA PPDB MotifGCCCA  PLACE Motif 
REGGTGGCCCATGG+3692563036925640-182-172
 OsREG653GTGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG488 TGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG517  GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG525   GCCCATGG PPDB MotifGCCCA, CCATGG  PLACE Motif 
REGGGGCGAGG+3692566836925675-144-137
 OsREG549GGGCGAGG PPDB MotifGCCCA  PLACE Motif 
REGGTTGGTGG+3692568036925687-132-125
 OsREG520GTTGGTGG PPDB MotifCCAACGG  PLACE Motif 
REGGGTGGATGGG+3692568936925698-123-114
 OsREG515GGTGGATG   PPDB Motif  PLACE Motif 
 OsREG534  TGGATGGG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.