version
PlantPromoterDB promoter information of J100055J24

Summary of Gene (J100055J24)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0133800        NCBI 
Gene model J100055J24  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 1783706-1784905)

Genome position     
from initiation codon
006-092-D12         
006-111-G01         
AK103646            
AK109376            
D37886              
J033135B19          
J065200F01          
J065213J11          
J075031N16          
J075032N17          
J075047P04          
J075063D01          
J075105F23          
J075121E16          
J075176F10          
J075182M16          
J075190E09          
J075191B14          
J100066H24          
J100073N01          
TSS from cDNA
TSS information
J100055J24                       5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J100055J24

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+1784613-93
TSS clone peakAclone+1784629-77

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCTGGGCCAAAGCCCAATT+17843391784357-367-349
 OsREG550CCTGGGCC            PPDB MotifGCCCA  PLACE Motif 
 OsREG578 CTGGGCCA           PPDB MotifGCCCA  PLACE Motif 
 OsREG660  TGGGCCAA          PPDB MotifGCCCA  PLACE Motif 
 OsREG421        AAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG426         AAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG460          AGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG433           GCCCAATT PPDB MotifGCCCA  PLACE Motif 
REGTCGGCCCAAAA+17843721784382-334-324
 OsREG658TCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563 CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625  GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG592   GCCCAAAA PPDB MotifGCCCA  PLACE Motif 
REGCGTGTGGGCCCC+17844921784503-214-203
 OsREG526CGTGTGGG     PPDB MotifGCCCA  PLACE Motif 
 OsREG598 GTGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG627  TGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GTGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG647    TGGGCCCC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.