version
PlantPromoterDB promoter information of J100057B19

Summary of Gene (J100057B19)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0357200        NCBI 
Gene model J100057B19  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 16905339-16906538)

Genome position     
from initiation codon
014-046-H09         
AK064069            
AK072064            
J065038M01          
J065121C16          
J075173E09          
J080307A20          
J090046B19          
J100033N12          
J100036G01          
TSS from cDNA
TSS information
J100057B19                       5'->3' (+)
Promoter sequence












 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J100057B19

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+16905972-367
TSS clone peakAclone+16905973-366

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCGTGGGCCCCACGGCC+1690571116905727-628-612
 OsREG601TCGTGGGC          PPDB MotifGCCCA  PLACE Motif 
 OsREG571 CGTGGGCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG647   TGGGCCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG641    GGGCCCCA      PPDB MotifGCCCA  PLACE Motif 
 OsREG631     GGCCCCAC     PPDB Motif  PLACE Motif 
 OsREG572      GCCCCACG    PPDB Motif  PLACE Motif 
 OsREG521         CCACGGCC PPDB Motif  PLACE Motif 
REGGGTCCACG+1690575416905761-585-578
 OsREG570GGTCCACG PPDB Motif  PLACE Motif 
REGCCACTGACACGTGGACC+1690584116905857-498-482
 OsREG522CCACTGAC          PPDB Motif  PLACE MotifTGAC 
 OsREG510 CACTGACA         PPDB Motif  PLACE MotifTGAC 
 OsREG509     GACACGTG     PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434      ACACGTGG    PPDB MotifACGT  PLACE Motif 
 OsREG570         CGTGGACC PPDB Motif  PLACE Motif 
REGGGTCCCACC+1690587316905881-466-458
 OsREG650GGTCCCAC  PPDB MotifGGGACCC  PLACE Motif 
 OsREG651 GTCCCACC PPDB MotifGGGACCC  PLACE Motif 
REGGCCCCACGTGGGCCCCACGCCTC+1690589916905921-440-418
 OsREG572GCCCCACG   GCCCCACG     PPDB Motif  PLACE Motif 
 OsREG450 CCCCACGT               PPDB MotifACGT  PLACE Motif 
 OsREG508  CCCACGTGGG            PPDB MotifACGT  PLACE Motif 
 OsREG449     ACGTGGGC           PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG571      CGTGGGCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG640       GTGGGCCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG647        TGGGCCCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG641         GGGCCCCA       PPDB MotifGCCCA  PLACE Motif 
 OsREG631          GGCCCCAC      PPDB Motif  PLACE Motif 
 OsREG503               CACGCCTC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.