version
PlantPromoterDB promoter information of J100057N04

Summary of Gene (J100057N04)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0352800        NCBI 
Gene model J100057N04  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 13313593-13312394)

Genome position     
from initiation codon
009-030-G08         
AK059673            
J023060F17          
J075050N19          
J075104J18          
J100050I19          
J100052N21          
TSS from cDNA
TSS information
J100057N04                       5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J100057N04

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-13312637-44

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTTCCCTCCTCTCTC-13312589133126044-11
Y PatchTTCTCCTC-1331262513312632-32-39
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAGGCCCACAAGGCCC-1331267713312692-84-99
 OsREG430AAGGCCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG472 AGGCCCAC        PPDB MotifGCCCA  PLACE Motif 
 OsREG627  GGCCCACA       PPDB MotifGCCCA  PLACE Motif 
 OsREG597   GCCCACAA      PPDB MotifGCCCA  PLACE Motif 
 OsREG497        CAAGGCCC PPDB MotifGCCCA  PLACE Motif 
REGACATGGGCCGTA-1331271613312727-123-134
 OsREG437ACATGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG517 CATGGGCC    PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG490  ATGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG445   TGGGCCGT  PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG645    GGGCCGTA PPDB MotifGCCCA  PLACE Motif 
REGTGTGGGGCCCACA-1331287913312891-286-298
 OsREG611TGTGGGGC      PPDB Motif  PLACE Motif 
 OsREG631 GTGGGGCC     PPDB Motif  PLACE Motif 
 OsREG641  TGGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG647   GGGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG640    GGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG627     GGCCCACA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.