version
PlantPromoterDB promoter information of J100059N21

Summary of Gene (J100059N21)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0193500        NCBI 
Gene model J100059N21  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 5206169-5207368)

Genome position     
from initiation codon
009-036-F07         
009-092-G09         
AK101237            
J033031K13          
J033034P12          
J065118P22          
J080304L19          
J090050G14          
J090098C16          
TSS from cDNA
TSS information
J100059N21                       5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J100059N21

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+5207168-1

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCTCCTC+52071565207164-13-5
Y PatchTCCTCCTCTCC+52071785207188919
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGACACGTG+52068945206901-275-268
 OsREG509GACACGTG PPDB MotifACGT  PLACE MotifACGTGKC 
REGGCCCAACC+52070145207021-155-148
 OsREG595GCCCAACC PPDB MotifGCCCA  PLACE Motif 
REGCTCGGCCCGGCCC+52070275207039-142-130
 OsREG575CTCGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG568 TCGGCCCG     PPDB MotifACGGGC  PLACE Motif 
 OsREG544  CGGCCCGG    PPDB Motif  PLACE Motif 
 OsREG616   GGCCCGGC   PPDB Motif  PLACE Motif 
 OsREG614    GCCCGGCC  PPDB Motif  PLACE Motif 
 OsREG538     CCCGGCCC PPDB MotifGCCCA  PLACE Motif 
REGTGCGGCCCACGCG+52070845207096-85-73
 OsREG643TGCGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG618 GCGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG564  CGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG571   GGCCCACG   PPDB MotifGCCCA  PLACE Motif 
 OsREG602    GCCCACGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG530     CCCACGCG PPDB MotifGCCCA  PLACE Motif 
REGTCTCGGCCCATCA+52071005207112-69-57
 OsREG635TCTCGGCC      PPDB Motif  PLACE Motif 
 OsREG575 CTCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG658  TCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490   CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590    GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG607     GCCCATCA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.