version
PlantPromoterDB promoter information of J100062C01

Summary of Gene (J100062C01)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0782700        NCBI 
Gene model J100062C01  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 34090380-34089181)

Genome position     
from initiation codon
005-009-B03         
006-065-C12         
011-016-A10         
011-027-G10         
011-078-C10         
012-039-F02         
012-059-F07         
012-088-B06         
012-088-C06         
012-090-F01         
015-002-C09         
015-004-C04         
015-024-F11         
015-038-C01         
015-053-H02         
015-057-G04         
016-010-H02         
016-018-C07         
016-048-B11         
016-062-D03         
016-077-H03         
AF193803            
AK064027            
AK103783            
AK119643            
AK119885            
J013021I16          
J013049O14          
J013063K17          
J013072M15          
J023027O06          
J023065O13          
J033061L05          
J033071D23          
J033091P12          
J033124J07          
J033144H23          
J033145H23          
J065063N13          
J065186B09          
J075055I18          
J075177O06          
J090008G10          
J090050I24          
J090062F21          
J090071M09          
J090078M03          
J100018N15          
J100035P04          
J100037E03          
J100045D04          
J100065C13          
J100068N10          
J100074A11          
J100077G20          
TSS from cDNA
TSS information
J100062C01                       5'->3' (-)
Promoter sequence












 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J100062C01

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakTclone-34089542-162
TSS clone peakCclone-34089541-161

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCATATAAAAA-3408956834089578-188-198
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTGACAGGTGGGCCCCACCAC-3408960034089620-220-240
 OsREG551CTGACAGG              PPDB Motif  PLACE MotifTGAC 
 OsREG501  GACAGGTG            PPDB Motif  PLACE Motif 
 OsREG436   ACAGGTGG           PPDB Motif  PLACE Motif 
 OsREG514    CAGGTGGG          PPDB MotifGCCCA  PLACE Motif 
 OsREG476     AGGTGGGC         PPDB MotifGCCCA  PLACE Motif 
 OsREG628      GGTGGGCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG640       GTGGGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG647        TGGGCCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG641         GGGCCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG631          GGCCCCAC    PPDB Motif  PLACE Motif 
 OsREG612           GCCCCACC   PPDB Motif  PLACE Motif 
 OsREG527             CCCACCAC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.