version
PlantPromoterDB promoter information of J100065E13

Summary of Gene (J100065E13)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0510200        NCBI 
Gene model J100065E13  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 19013531-19014730)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
J100065E13                       5'->3' (+)
Promoter sequence

 
AK058487            
AK122107            
J033126F06          
J053077L04          
J065010C11          
J075104O14          
J080003G03          
J080014K05          
J080026F03          
J080027O05          
J080037K15          
J080039D24          
J080043G19          
J080047P05          
J080048D22          
J080049F23          
J080062A21          
J080063H20          
J080067P15          
J080068P19          
J080079J15          
J080092K19          
J080096M04          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence



 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J100065E13

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone-19014641AK122107, AK058487, AK122107, J033126F06, J053077L04, J075104O14, J065010C11, J080003G03, J080014K05, J080026F03, J080027O05, J080037K15, J080039D24, J080043G19, J080047P05, J080048D22, J080049F23, J080062A21, J080063H20, J080067P15, J080068P19, J080079J15, J080092K19, J080096M04

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGACAGGTGGG-1901472519014734AK058487, AK122107, J033126F06, J053077L04, J065010C11, J075104O14, J080003G03, J080014K05, J080026F03, J080027O05, J080037K15, J080039D24, J080043G19, J080047P05, J080048D22, J080049F23, J080062A21, J080063H20, J080067P15, J080068P19, J080079J15, J080092K19, J080096M04
 OsREG501GACAGGTG   PPDB Motif  PLACE Motif 
 OsREG436 ACAGGTGG  PPDB Motif  PLACE Motif 
 OsREG514  CAGGTGGG PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.