version
PlantPromoterDB promoter information of J100066K23

Summary of Gene (J100066K23)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0768600        NCBI 
Gene model J100066K23  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 33260864-33262063)

Genome position     
from initiation codon
006-034-F01         
006-046-G07         
006-054-C07         
006-056-F07         
006-100-C02         
AK059725            
AK060304            
AK098996            
AK099120            
AK104659            
J065043H04          
J075034N21          
J075145C18          
J080016H01          
J080040F01          
J080047L23          
J080049B22          
J080062J16          
J080064C23          
J080064L22          
J080077N01          
J080097G17          
J100065L15          
J100088C07          
J100090H09          
TSS from cDNA
TSS information
J100066K23                       5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J100066K23

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+33261776-88
TSS clone peakAclone+33261781-83

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGGTGGGCCGGA+3326158033261591-284-273
 OsREG476AGGTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG628 GGTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG564  GTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG644    GGGCCGGA PPDB MotifGCCCA  PLACE Motif 
REGTCCGGGCC+3326160733261614-257-250
 OsREG633TCCGGGCC PPDB Motif  PLACE Motif 
REGTCTGGCCCGGCCCAAAC+3326164233261658-222-206
 OsREG638TCTGGCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG616   GGCCCGGC       PPDB Motif  PLACE Motif 
 OsREG614    GCCCGGCC      PPDB Motif  PLACE Motif 
 OsREG538     CCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542      CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563       CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625        GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG593         GCCCAAAC PPDB MotifGCCCA  PLACE Motif 
REGGGGTGGGCCCACCTG+3326170833261722-156-142
 OsREG600GGGTGGGC        PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG628 GGTGGGCCCACC   PPDB MotifGCCCA  PLACE Motif 
 OsREG476      GCCCACCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG514       CCCACCTG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.