version
PlantPromoterDB promoter information of J100070P06

Summary of Gene (J100070P06)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0104600        NCBI 
Gene model J100070P06  
Description NONE  
#
#

Overview

Focused view (chromosome 8: 242545-241346)

Genome position     
from initiation codon
005-006-A07         
006-083-A08         
009-022-C08         
009-027-A01         
009-030-E07         
009-042-H08         
009-048-E08         
009-051-F07         
009-051-H06         
009-054-E02         
009-084-D01         
009-089-A03         
009-105-H12         
009-109-D02         
009-110-H12         
009-117-A05         
009-117-C08         
009-118-F09         
009-119-E03         
009-122-G10         
009-125-H06         
009-126-A06         
009-127-H02         
009-128-B09         
009-129-B09         
009-130-D05         
009-130-D08         
009-139-D08         
009-149-D07         
009-150-C04         
009-154-E03         
009-155-C06         
009-165-B08         
009-167-C06         
009-181-H11         
009-191-F03         
009-192-C06         
009-195-F03         
009-196-G08         
009-197-D08         
014-052-E10         
AF010320            
AK061654            
AK119206            
AK119709            
AK120393            
AY072818            
D30763              
J013043A04          
J013058K06          
J013059G01          
J013067N20          
J013074D04          
J013075A06          
J013093N12          
J013094P22          
J013119N05          
J013120G18          
J013129G02          
J013129P10          
J013159F22          
J013160D20          
J013160E23          
J023034F18          
J023048F04          
J023048O08          
J023049B18          
J023061A17          
J023072A03          
J023085A16          
J023087L09          
J043012O13          
J065038A14          
J065187M18          
J065205M17          
J080301G10          
J080311I12          
J080311O19          
J080312C16          
J080317L04          
J090027H09          
J090053F07          
J090055C23          
J090071A18          
J090084O10          
J090091C23          
J090093J04          
J100061N06          
J100074K15          
TSS from cDNA
TSS information
J100070P06                       5'->3' (-)
Promoter sequence







 
009-147-C03         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J100070P06

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone-241629-84
TSS clone peakAclone-241628-83
TSS cloneAclone-241626-81

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCTCTCCTCCTC-241598241611-53-66
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGCCACGTGGC-241678241688-133-143
 OsREG448CGCCACGT    PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG507 GCCACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 
REGCCCATCCA-241721241728-176-183
 OsREG534CCCATCCA PPDB MotifGCCCA  PLACE Motif 
REGGGACGGCC-241916241923-371-378
 OsREG624GGACGGCC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.