version
PlantPromoterDB promoter information of J100072F13

Summary of Gene (J100072F13)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0673500        NCBI 
Gene model J100072F13  
Description Similar to Ubiquitin.  
#
#

Overview

Focused view (chromosome 6: 28837329-28836130)

Genome position     
from initiation codon
J100018J12          
TSS from cDNA
TSS information
J100072F13                       5'->3' (-)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J100072F13

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-28837091-762

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCCC-2883713228837139-803-810
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGACGGCCCATGT-2883714928837160-820-831
 OsREG584GACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG445 ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG490  CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG517   GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG437    GCCCATGT PPDB MotifGCCCA  PLACE Motif 
REGGACGCGACGC-2883716728837176-838-847
 OsREG583GACGCGAC   PPDB Motif  PLACE Motif 
 OsREG556  CGCGACGC PPDB Motif  PLACE MotifCGACG 
REGTATGGGCCCAGA-2883721528837226-886-897
 OsREG630TATGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG489 ATGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG579   GGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG629    GGCCCAGA PPDB MotifGCCCA  PLACE Motif 
REGATATGGGCTCAGCCCAGCCCATCA-2883726328837286-934-957
 OsREG480ATATGGGC                 PPDB MotifGCCCA  PLACE Motif 
 OsREG465 TATGGGCT                PPDB MotifGCCCA  PLACE Motif 
 OsREG657        TCAGCCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG512         CAGCCCAG        PPDB MotifGCCCA  PLACE Motif 
 OsREG464          AGCCCAGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG603           GCCCAGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG533            CCCAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG523             CCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG491              CAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG466               AGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG607                GCCCATCA PPDB MotifGCCCA  PLACE Motif 
REGGCCCCACA-2883728928837296-960-967
 OsREG611GCCCCACA PPDB Motif  PLACE Motif 
REGCCATGGGCCTT-2883731028837320-981-991
 OsREG525CCATGGGC    PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG517 CATGGGCC   PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG474  ATGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG430   TGGGCCTT PPDB MotifGCCCA  PLACE Motif 
REGGCAGCCCAAAT-2883733028837340-1001-1011
 OsREG591GCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG511 CAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG457  AGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG493   GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGGCCCAATA-2883734428837351-1015-1022
 OsREG596GCCCAATA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.