version
PlantPromoterDB promoter information of J100073O10

Summary of Gene (J100073O10)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0265000        NCBI 
Gene model J100073O10  
Description NONE  
#
#

Overview

Focused view (chromosome 6: 8765560-8764361)

Genome position     
from initiation codon
AK100247            
D83378              
J013033O15          
J013037H24          
J013037K20          
J013058I07          
J013091F16          
J013102O12          
J023041D13          
J023058E10          
J023061K08          
J023063P21          
J023075P04          
J023086H06          
J023129C09          
J023143C09          
J023150F07          
J033055F14          
J033107G14          
J033125B12          
J033125M21          
J033128M23          
J033140B02          
J033142B02          
J033149N14          
J043003H01          
J043030E23          
J043034K11          
J053035F08          
J053048O12          
J053050B10          
J053061I09          
J053066A05          
J053068F17          
J053074G11          
J053089L06          
J053095N11          
J065158J20          
J075019H02          
J090028M17          
J090031O08          
J090094C22          
J100045M24          
J100055P03          
J100060G12          
J100060K14          
J100064E21          
J100075J10          
J100081K21          
U55873              
TSS from cDNA
TSS information
J100073O10                       5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J100073O10

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-8764705-145
TSS clone peakGclone-8764681-121

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTCCTCTT-87646628764671-102-111
Y PatchTCCCCTCTCCTCCCTC-87647148764729-154-169
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATCCGACGG-87647688764776-208-216
 OsREG483ATCCGACG  PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG546 TCCGACGG PPDB MotifCCGAC  PLACE MotifCGACG 
REGCGCGTGCG-87648118764818-251-258
 OsREG555CGCGTGCG PPDB Motif  PLACE Motif 
REGGGGACCCAC-87649058764913-345-353
 OsREG637GGGACCCA  PPDB MotifGGGACCC  PLACE Motif 
 OsREG622 GGACCCAC PPDB MotifGGGACCC  PLACE Motif 
REGCCCACGCGTCTC-87649398764950-379-390
 OsREG530CCCACGCG     PPDB MotifGCCCA  PLACE Motif 
 OsREG443 CCACGCGT    PPDB Motif  PLACE Motif 
 OsREG560    CGCGTCTC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.