version
PlantPromoterDB promoter information of J100074E23

Summary of Gene (J100074E23)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0833200        NCBI 
Gene model J100074E23  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 37437763-37438962)

Genome position     
from initiation codon
AK121629            
J023093N07          
J033050C20          
J053094M21          
J065025N05          
J065025N06          
J065112I17          
J065137H15          
J080302F22          
J080303H06          
J080306J04          
J080309K06          
J080311E18          
J080318A20          
J090033D03          
J090070E12          
J100027O07          
J100031F20          
J100034P21          
J100042K08          
J100047H24          
J100065C14          
TSS from cDNA
TSS information
J100074E23                       5'->3' (+)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J100074E23

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+37438690-73

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTTCTCC+3743865837438665-105-98
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTCGGCCCCCACG+3743846037438472-303-291
 OsREG642TTCGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG613    GCCCCCAC  PPDB Motif  PLACE Motif 
 OsREG536     CCCCCACG PPDB Motif  PLACE Motif 
REGCGCGTCGCGCG+3743855937438569-204-194
 OsREG559CGCGTCGC    PPDB Motif  PLACE MotifCGACG 
 OsREG556 GCGTCGCG   PPDB Motif  PLACE MotifCGACG 
 OsREG557   GTCGCGCG PPDB MotifACGCGC  PLACE Motif 
REGGGTGGGAC+3743861037438617-153-146
 OsREG651GGTGGGAC PPDB MotifGGGACCC  PLACE Motif 
REGACTGGGCCTGG+3743863437438644-129-119
 OsREG454ACTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG473 CTGGGCCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG513  TGGGCCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG524   GGGCCTGG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.