version
PlantPromoterDB promoter information of J100075D01

Summary of Gene (J100075D01)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0142900        NCBI 
Gene model J100075D01  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 2360710-2359511)

Genome position     
from initiation codon
AK073102            
J033022E04          
J033051I24          
J065104A15          
TSS from cDNA
TSS information
J100075D01                       5'->3' (-)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J100075D01

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-2356371-161

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCAGGCCCAGGCCCAGGCCCGGCCC-23564272356451-217-241
 OsREG524CCAGGCCCAGGCCCAGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG513 CAGGCCCAGGCCCA           PPDB MotifGCCCA  PLACE Motif 
 OsREG473  AGGCCCAGGCCCAG          PPDB MotifGCCCA  PLACE Motif 
 OsREG550   GGCCCAGGCCCAGG         PPDB MotifGCCCA  PLACE Motif 
 OsREG616               GGCCCGGC   PPDB Motif  PLACE Motif 
 OsREG614                GCCCGGCC  PPDB Motif  PLACE Motif 
 OsREG538                 CCCGGCCC PPDB MotifGCCCA  PLACE Motif 
REGCCCAGCCCAG-23564542356463-244-253
 OsREG533CCCAGCCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG523 CCAGCCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG512  CAGCCCAG PPDB MotifGCCCA  PLACE Motif 
REGCAACGGCCCATT-23564842356495-274-285
 OsREG494CAACGGCC     PPDB MotifCCAACGG  PLACE Motif 
 OsREG423 AACGGCCC    PPDB MotifGCCCA, AAACG(C/G)  PLACE Motif 
 OsREG445  ACGGCCCA   PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG490   CGGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG431    GGCCCATT PPDB MotifGCCCA  PLACE Motif 
REGGGACACGT-23565692356576-359-366
 OsREG451GGACACGT PPDB MotifACGT  PLACE MotifACGTGKC 
REGGAAGCCCATCT-23566252356635-415-425
 OsREG582GAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG429 AAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG466  AGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG456   GCCCATCT PPDB MotifGCCCA  PLACE Motif 
REGATCCCCCA-23566452356652-435-442
 OsREG482ATCCCCCA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.