version
PlantPromoterDB promoter information of J100080L02

Summary of Gene (J100080L02)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0585800        NCBI 
Gene model J100080L02  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 24463702-24462503)

Genome position     
from initiation codon
006-106-A05         
AK066419            
AK105064            
J013066N17          
J065065N01          
J065082H12          
J065085B08          
J065099I23          
J065169A01          
J065187N13          
J065191L18          
J065194D04          
J065211M09          
J065212I02          
J090003C10          
J090025O11          
J090092F10          
J100055A04          
J100064A01          
TSS from cDNA
TSS information
J100080L02                       5'->3' (-)
Promoter sequence












 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J100080L02

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-24462790-88

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCTTCTC-2446274324462750-41-48
Y PatchCTCTCTCTCTCTCTCTCTC-2446278024462798-78-96
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTGGCCCAACA-2446285624462866-154-164
 OsREG660TTGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG659 TGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626  GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG594   GCCCAACA PPDB MotifGCCCA  PLACE Motif 
REGACTGGGCCGAGA-2446287024462881-168-179
 OsREG454ACTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG565 CTGGGCCG    PPDB MotifGCCCA  PLACE Motif 
 OsREG658  TGGGCCGA   PPDB MotifGCCCA  PLACE Motif 
 OsREG575   GGGCCGAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG635    GGCCGAGA PPDB Motif  PLACE Motif 
REGTCTGGGCCGCAAGGCCCGGCCCATAA-2446290124462926-199-224
 OsREG629TCTGGGCC                   PPDB MotifGCCCA  PLACE Motif 
 OsREG565 CTGGGCCG                  PPDB MotifGCCCA  PLACE Motif 
 OsREG618  TGGGCCGC                 PPDB MotifGCCCA  PLACE Motif 
 OsREG643   GGGCCGCA                PPDB MotifGCCCA  PLACE Motif 
 OsREG497         CAAGGCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG616            GGCCCGGC       PPDB Motif  PLACE Motif 
 OsREG614             GCCCGGCC      PPDB Motif  PLACE Motif 
 OsREG538              CCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542               CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490                CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630                 GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG605                  GCCCATAA PPDB MotifGCCCA  PLACE Motif 
REGAACTGGGCCCAGC-2446295524462967-253-265
 OsREG425AACTGGGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG454 ACTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG579  CTGGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG620     GGCCCAGC PPDB MotifGCCCA  PLACE Motif 
REGGTATGGGCCTT-2446300224463012-300-310
 OsREG606GTATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG430   TGGGCCTT PPDB MotifGCCCA  PLACE Motif 
REGTCTGGACC-2446304024463047-338-345
 OsREG649TCTGGACC PPDB Motif  PLACE Motif 
REGGTCAGTGG-2446305224463059-350-357
 OsREG522GTCAGTGG PPDB Motif  PLACE MotifTGAC 
REGGCCGGCCCAGAT-2446306224463073-360-371
 OsREG615GCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG565  CGGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG629   GGCCCAGA  PPDB MotifGCCCA  PLACE Motif 
 OsREG486    GCCCAGAT PPDB MotifGCCCA  PLACE Motif 
REGCAGCCCAATA-2446308124463090-379-388
 OsREG511CAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG460 AGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG596  GCCCAATA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.