version
PlantPromoterDB promoter information of J100080N22

Summary of Gene (J100080N22)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0625500        NCBI 
Gene model J100080N22  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 25834495-25833296)

Genome position     
from initiation codon
006-033-A01         
006-081-F05         
006-113-D09         
011-025-C06         
016-011-B01         
AB050624            
AK059188            
AK059771            
AK101791            
AY224510            
J013152H02          
J023012P09          
J023127D16          
J023136N18          
J033024G01          
J033025L19          
J033065J11          
J033080M04          
J033101A08          
J033121L12          
J043017N15          
J065207J01          
J090049G12          
J100036A07          
J100076C04          
TSS from cDNA
TSS information
J100080N22                       5'->3' (-)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J100080N22

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakTclone-25833509-14

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCTCCTC-2583349625833505-1-10
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGTGGGCCCC-2583356125833570-66-75
 OsREG478AGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GTGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG647  TGGGCCCC PPDB MotifGCCCA  PLACE Motif 
REGGCCCACCAACCGCGGGGG-2583358925833606-94-111
 OsREG599GCCCACCA           PPDB MotifGCCCA  PLACE Motif 
 OsREG520  CCACCAAC         PPDB MotifCCAACGG  PLACE Motif 
 OsREG537          CGCGGGGG PPDB Motif  PLACE Motif 
REGGGAGTGGG-2583362225833629-127-134
 OsREG532GGAGTGGG PPDB MotifGCCCA  PLACE Motif 
REGGTCAGTGG-2583366925833676-174-181
 OsREG522GTCAGTGG PPDB Motif  PLACE MotifTGAC 
REGCCCGGGCCCGCA-2583367825833689-183-194
 OsREG539CCCGGGCC     PPDB Motif  PLACE Motif 
 OsREG543 CCGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG619   GGGCCCGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG632    GGCCCGCA PPDB Motif  PLACE Motif 
REGAGCTGAGCGTCGCG-2583373025833743-235-248
 OsREG470AGCTGAGC       PPDB Motif  PLACE Motif 
 OsREG556      GCGTCGCG PPDB Motif  PLACE MotifCGACG 
REGGTTGGTGGGC-2583377825833787-283-292
 OsREG520GTTGGTGG   PPDB MotifCCAACGG  PLACE Motif 
 OsREG599  TGGTGGGC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakCclone-25833355AK059188

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTTCCTC-2583332525833332AK059188
Y PatchCCCCCTCCT-2583335925833367AK059188
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGCGGAGAG-2583341125833418AK059188
 OsREG576GCGGAGAG PPDB Motif  PLACE Motif 
REGAGCCCAACT-2583353825833546AK059188
 OsREG458AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG479 GCCCAACT PPDB MotifGCCCA  PLACE Motif 
REGGTTTGGGC-2583354825833555AK059188
 OsREG593GTTTGGGC PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.