version
PlantPromoterDB promoter information of J100084F17

Summary of Gene (J100084F17)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0670200        NCBI 
Gene model J100084F17  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 27208385-27209584)

Genome position     
from initiation codon
011-069-G05         
AK069553            
J023020O11          
J023114J22          
J100087A11          
TSS from cDNA
TSS information
J100084F17                       5'->3' (+)
Promoter sequence







 
AK071650            
J013126O06          
J023105K03          
J065058N24          
J065097M04          
J065163F14          
J090045F11          
J090088H23          
J100035C13          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J100084F17

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+27209293-92

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCTCCCCC+2720931027209318-75-67
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCGTGGGC+2720905827209065-327-320
 OsREG602GCGTGGGC PPDB MotifGCCCA  PLACE Motif 
REGGCGGAGAG+2720907527209082-310-303
 OsREG576GCGGAGAG PPDB Motif  PLACE Motif 
REGCGCGTGGGCGAGG+2720914227209154-243-231
 OsREG530CGCGTGGG      PPDB MotifGCCCA  PLACE Motif 
 OsREG602 GCGTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG549     GGGCGAGG PPDB MotifGCCCA  PLACE Motif 
REGCCCCCACGTGGC+2720920727209218-178-167
 OsREG536CCCCCACG     PPDB Motif  PLACE Motif 
 OsREG450 CCCCACGT    PPDB MotifACGT  PLACE Motif 
 OsREG508  CCCACGTG   PPDB MotifACGT  PLACE Motif 
 OsREG507    CACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 
REGTGTGGGCCCCACCGATCCG+2720922827209246-157-139
 OsREG627TGTGGGCC            PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GTGGGCCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG647  TGGGCCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG641   GGGCCCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG631    GGCCCCAC        PPDB Motif  PLACE Motif 
 OsREG612     GCCCCACC       PPDB Motif  PLACE Motif 
 OsREG541           CCGATCCG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.