version
PlantPromoterDB promoter information of J100086A03

Summary of Gene (J100086A03)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0815100        NCBI 
Gene model J100086A03  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 35015912-35017111)

Genome position     
from initiation codon
006-022-A04         
006-032-F09         
012-044-F04         
012-051-A11         
014-094-A11         
016-048-F09         
AK067690            
AK099245            
AK104551            
AK104712            
AY596808            
J013023I21          
J013027O21          
J013027P22          
J013039E09          
J013070D18          
J013120D02          
J013124K09          
J023010G16          
J023012B04          
J023012O20          
J023019D19          
J023045H15          
J023049M06          
J023052G12          
J023052L12          
J023056N15          
J023082P03          
J023130J01          
J023136J03          
J033032A20          
J033048C16          
J033081C19          
J033086J21          
J033139O19          
J043013G20          
J043040J11          
J065010G15          
J065020E20          
J065039K24          
J065056M11          
J065065I09          
J065103L22          
J065117P20          
J065167C22          
J065168L06          
J065182A21          
J065191E11          
J065215E01          
J090015D12          
J090024E16          
J090077P07          
J100024A01          
J100029O14          
J100036E17          
J100059P22          
J100067K06          
J100080A22          
TSS from cDNA
TSS information
J100086A03                       5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J100086A03

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+35016833-79

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCTCTATATATC+3501679535016806-117-106
Y PatchCCTCCCTCT+3501679135016799-121-113
Y PatchCCCCCCTCC+3501680735016815-105-97
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGCACCGC+3501656835016575-344-337
 OsREG554CGCACCGC PPDB Motif  PLACE Motif 
REGCCCACCAC+3501668335016690-229-222
 OsREG527CCCACCAC PPDB MotifGCCCA  PLACE Motif 
REGCATCCCCC+3501676135016768-151-144
 OsREG516CATCCCCC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.