version
PlantPromoterDB promoter information of J100086K17

Summary of Gene (J100086K17)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0819700        NCBI 
Gene model J100086K17  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 36088658-36087459)

Genome position     
from initiation codon
AK067374            
AK099160            
TSS from cDNA
TSS information
J100086K17                       5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J100086K17

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-36087756-98

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCTCTCTCT-3608777036087780-112-122
Y PatchCTCCCCTT-3608779036087797-132-139
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCAAGGCCCACACG-3608779836087810-140-152
 OsREG497CAAGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG430 AAGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG472  AGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG627   GGCCCACA   PPDB MotifGCCCA  PLACE Motif 
 OsREG598    GCCCACAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG526     CCCACACG PPDB MotifGCCCA  PLACE Motif 
REGAGGGCCCAATT-3608781836087828-160-170
 OsREG475AGGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG639 GGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG492  GGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG433   GCCCAATT PPDB MotifGCCCA  PLACE Motif 
REGTGGATGGGCTGTATTGGGCCTC-3608784936087870-191-212
 OsREG534TGGATGGG               PPDB MotifGCCCA  PLACE Motif 
 OsREG608 GGATGGGC              PPDB MotifGCCCA  PLACE Motif 
 OsREG466  GATGGGCT             PPDB MotifGCCCA  PLACE Motif 
 OsREG491   ATGGGCTG            PPDB MotifGCCCA  PLACE Motif 
 OsREG435    TGGGCTGT           PPDB MotifGCCCA  PLACE Motif 
 OsREG596           TATTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG492            ATTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG471             TTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG587              TGGGCCTC PPDB MotifGCCCA  PLACE Motif 
REGCTCGGCCCAGTT-3608789736087908-239-250
 OsREG575CTCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG658 TCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG565  CGGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG454   GGCCCAGT  PPDB MotifGCCCA  PLACE Motif 
 OsREG425    GCCCAGTT PPDB MotifGCCCA  PLACE Motif 
REGTCGGCCCACAA-3608791936087929-261-271
 OsREG658TCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG564 CGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG627  GGCCCACA  PPDB MotifGCCCA  PLACE Motif 
 OsREG597   GCCCACAA PPDB MotifGCCCA  PLACE Motif 
REGTAGGCCCATA-3608793636087945-278-287
 OsREG656TAGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG474 AGGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG630  GGCCCATA PPDB MotifGCCCA  PLACE Motif 
REGCTTGGGCT-3608795836087965-300-307
 OsREG459CTTGGGCT PPDB MotifGCCCA  PLACE Motif 
REGTAGGCCCAATT-3608797936087989-321-331
 OsREG656TAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG471 AGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG492  GGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG433   GCCCAATT PPDB MotifGCCCA  PLACE Motif 
REGTATTGGGCT-3608801136088019-353-361
 OsREG596TATTGGGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG460 ATTGGGCT PPDB MotifGCCCA  PLACE Motif 
REGGTTTGGGCCGAA-3608803636088047-378-389
 OsREG593GTTTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG563  TTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG658   TGGGCCGA  PPDB MotifGCCCA  PLACE Motif 
 OsREG642    GGGCCGAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.