version
PlantPromoterDB promoter information of J100088H21

Summary of Gene (J100088H21)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0683400        NCBI 
Gene model J100088H21  
Description NONE  
#
#

Overview

Focused view (chromosome 6: 29360903-29362102)

Genome position     
from initiation codon
009-047-C07         
009-060-B06         
013-057-F12         
AK111852            
AK111897            
AK112082            
J065104C07          
J065187J11          
J065197L08          
J100045K14          
J100074M08          
TSS from cDNA
TSS information
J100088H21                       5'->3' (+)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J100088H21

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+29360814-89

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCTCCTCCCCT+2936076629360779-137-124
Y PatchCCTCCTCCCC+2936079129360800-112-103
Y PatchTCCCTCTCCTCTTCTCCTCCTCTC+2936081529360838-88-65
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGACGCGAC+2936055829360565-345-338
 OsREG583GACGCGAC PPDB Motif  PLACE Motif 
REGCCAGCCCACGCCCAACT+2936060729360623-296-280
 OsREG523CCAGCCCA          PPDB MotifGCCCA  PLACE Motif 
 OsREG463  AGCCCACG        PPDB MotifGCCCA  PLACE Motif 
 OsREG602   GCCCACGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG479         GCCCAACT PPDB MotifGCCCA  PLACE Motif 
REGCCCACACG+2936070529360712-198-191
 OsREG526CCCACACG PPDB MotifGCCCA  PLACE Motif 
REGCATCCACC+2936072629360733-177-170
 OsREG515CATCCACC PPDB Motif  PLACE Motif 
REGGAAGCCCACCAC+2936075529360766-148-137
 OsREG582GAAGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG427 AAGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG462  AGCCCACC   PPDB MotifGCCCA  PLACE Motif 
 OsREG599   GCCCACCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG527    CCCACCAC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.