version
PlantPromoterDB promoter information of J100089H06

Summary of Gene (J100089H06)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0586800        NCBI 
Gene model J100089H06  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 22434596-22433397)

Genome position     
from initiation codon
003-114-H11         
012-055-D12         
AK063765            
AK099302            
J023143D06          
J065054E13          
J065130D07          
J065196E01          
J065207P16          
J090004H06          
J090005H05          
J090022N15          
J090038M08          
J090080H10          
J100035E05          
J100041L05          
J100041M18          
J100057P04          
J100060H20          
J100090C23          
TSS from cDNA
TSS information
J100089H06                       5'->3' (-)
Promoter sequence





 
011-018-B09         
AK099721            
J013088F16          
J013089L18          
J013149C13          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J100089H06

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-22433707-111

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCTTCTCC-2243367322433681-77-85
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTCGTGGGCCTA-2243377222433783-176-187
 OsREG529TTCGTGGG     PPDB MotifGCCCA  PLACE Motif 
 OsREG601 TCGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG571  CGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG472   GTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG656    TGGGCCTA PPDB MotifGCCCA  PLACE Motif 
REGCCAGGCCCATTT-2243379322433804-197-208
 OsREG524CCAGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG513 CAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474  AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG431   GGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG422    GCCCATTT PPDB MotifGCCCA  PLACE Motif 
REGTCATGGGCCAGGCCC-2243381722433831-221-235
 OsREG609TCATGGGC        PPDB MotifGCCCA  PLACE Motif 
 OsREG517 CATGGGCC       PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG488  ATGGGCCA      PPDB MotifGCCCA  PLACE Motif 
 OsREG577   TGGGCCAG     PPDB MotifGCCCA  PLACE Motif 
 OsREG524       CCAGGCCC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.