version
PlantPromoterDB promoter information of J100089H10

Summary of Gene (J100089H10)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0310800        NCBI 
Gene model J100089H10  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 11144831-11146030)

Genome position     
from initiation codon
009-126-C10         
009-156-D02         
015-065-F10         
AK058663            
AK064126            
AK099476            
J065084G15          
J075046C12          
J075058D24          
J075151M03          
J075151M04          
J075153I20          
J075167J05          
J075179G06          
J100025I19          
J100025L21          
J100029C06          
J100068E24          
J100070F10          
J100083H23          
TSS from cDNA
TSS information
J100089H10                       5'->3' (+)
Promoter sequence

 
AK108200            
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J100089H10

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+11144237-94
TSS clone peakGclone+11144239-92

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCTATAAATG+1114420311144212-128-119
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTCGCGCG+1114401311144020-318-311
 OsREG557GTCGCGCG PPDB MotifACGCGC  PLACE Motif 
REGAGCCCACCAAC+1114404911144059-282-272
 OsREG462AGCCCACC    PPDB MotifGCCCA  PLACE Motif 
 OsREG599 GCCCACCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG520   CCACCAAC PPDB MotifCCAACGG  PLACE Motif 
REGCACGTGGGCCAC+1114410011144111-231-220
 OsREG508CACGTGGG     PPDB MotifACGT  PLACE Motif 
 OsREG449 ACGTGGGC    PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG571  CGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG654   GTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG653    TGGGCCAC PPDB MotifGCCCA  PLACE Motif 
REGGGCCCGGA+1114417511144182-156-149
 OsREG633GGCCCGGA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.