version
PlantPromoterDB promoter information of J100089H12

Summary of Gene (J100089H12)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0502300        NCBI 
Gene model J100089H12  
Description NONE  
#
#

Overview

Focused view (chromosome 4: 25478490-25477291)

Genome position     
from initiation codon
009-116-F02         
009-130-H06         
AK120520            
J013124K01          
J023102F03          
J033094F17          
J053054C22          
J065024N13          
J065083J18          
J065132O14          
J065156M09          
J065176N15          
J065200E22          
J065208H08          
J075054B03          
J090007C07          
J090053E20          
J100075B09          
TSS from cDNA
TSS information
J100089H12                       5'->3' (-)
Promoter sequence












 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J100089H12

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-25477574-84

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCTCCC-2547753925477546-49-56
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCACGCCAC-2547762525477632-135-142
 OsREG502CACGCCAC PPDB Motif  PLACE Motif 
REGTCAGGCCCATCTCGGCCCACTCT-2547764525477667-155-177
 OsREG646TCAGGCCC                PPDB MotifGCCCA  PLACE Motif 
 OsREG513 CAGGCCCA               PPDB MotifGCCCA  PLACE Motif 
 OsREG474  AGGCCCAT              PPDB MotifGCCCA  PLACE Motif 
 OsREG590   GGCCCATC             PPDB MotifGCCCA  PLACE Motif 
 OsREG456    GCCCATCT            PPDB MotifGCCCA  PLACE Motif 
 OsREG485        ATCTCGGC        PPDB Motif  PLACE Motif 
 OsREG635         TCTCGGCC       PPDB Motif  PLACE Motif 
 OsREG575          CTCGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG658           TCGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG564            CGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG478             GGCCCACT   PPDB MotifGCCCA  PLACE Motif 
 OsREG455               CCCACTCT PPDB Motif  PLACE Motif 
REGTGCGGCCCATGT-2547769525477706-205-216
 OsREG643TGCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG618 GCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490  CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG517   GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG437    GCCCATGT PPDB MotifGCCCA  PLACE Motif 
REGTGAGGGAC-2547773925477746-249-256
 OsREG652TGAGGGAC PPDB MotifGGGACCC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.