version
PlantPromoterDB promoter information of Os01g0273300

Summary of Gene (Os01g0273300)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0273300        NCBI 
Gene model Os01g0273300  
Description BSD domain containing protein.  
#
#

Overview

Focused view (chromosome 1: 9453022-9454221)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
Os01g0273300                     5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of Os01g0273300

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+9453932-90

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCTCCTCC+94539609453969-62-53
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTGGCCCAGAT+94537569453766-266-256
 OsREG660TTGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG578 TGGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG629  GGCCCAGA  PPDB MotifGCCCA  PLACE Motif 
 OsREG486   GCCCAGAT PPDB MotifGCCCA  PLACE Motif 
REGCTGGGGCCCACCC+94538479453859-175-163
 OsREG580CTGGGGCC      PPDB Motif  PLACE Motif 
 OsREG641 TGGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647  GGGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628    GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG600     GCCCACCC PPDB MotifGCCCA  PLACE Motif 
REGGGTCCCACACG+94538659453875-157-147
 OsREG650GGTCCCAC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG526   CCCACACG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.