version
PlantPromoterDB promoter information of Os02g0304800

Summary of Gene (Os02g0304800)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0304800        NCBI 
Gene model Os02g0304800  
Description Protein prenyltransferase domain containing protein.  
#
#

Overview

Focused view (chromosome 2: 11904578-11905777)

Genome position     
from initiation codon
                    
Os02g0304701        
TSS from cDNA
TSS information
Os02g0304800                     5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of Os02g0304800

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+11905332-246

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCTCC+1190534511905352-233-226
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGGGGCCCACGTG+1190503311905045-545-533
 OsREG641TGGGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG647 GGGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG571   GGCCCACG   PPDB MotifGCCCA  PLACE Motif 
 OsREG449    GCCCACGT  PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG508     CCCACGTG PPDB MotifACGT  PLACE Motif 
REGGGCCCGGCCCAAAT+1190523711905250-341-328
 OsREG616GGCCCGGC       PPDB Motif  PLACE Motif 
 OsREG614 GCCCGGCC      PPDB Motif  PLACE Motif 
 OsREG538  CCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542   CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563    CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625     GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG493      GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGTCCGGCCCATTA+1190526811905279-310-299
 OsREG644TCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490  CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG431   GGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG610    GCCCATTA PPDB MotifGCCCA  PLACE Motif 
REGGAGGCCCAA+1190528311905291-295-287
 OsREG587GAGGCCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG471 AGGCCCAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.