version
PlantPromoterDB promoter information of Os02g0823700

Summary of Gene (Os02g0823700)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0823700        NCBI 
Gene model Os02g0823700  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 36266618-36265419)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
Os02g0823700                     5'->3' (-)
Promoter sequence

 
AK120318            
J075055J16          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence









 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of Os02g0823700

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone+36266239AK120318, J075055J16, AK120318

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGCCCATTT+3626596136265968AK120318, J075055J16
 OsREG422GCCCATTT PPDB MotifGCCCA  PLACE Motif 
REGGCAGCCCATACAACGGGCCCAACT+3626612336266146AK120318, J075055J16
 OsREG591GCAGCCCA                 PPDB MotifGCCCA  PLACE Motif 
 OsREG491 CAGCCCAT                PPDB MotifGCCCA  PLACE Motif 
 OsREG465  AGCCCATA               PPDB MotifGCCCA  PLACE Motif 
 OsREG606   GCCCATAC              PPDB MotifGCCCA  PLACE Motif 
 OsREG424           AACGGGCC      PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 
 OsREG566             CGGGCCCA    PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG639              GGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626               GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG479                GCCCAACT PPDB MotifGCCCA  PLACE Motif 
REGACCGGCCCATAT+3626617036266181AK120318, J075055J16
 OsREG440ACCGGCCC     PPDB MotifGCCCA, AACCG(G/A)  PLACE Motif 
 OsREG542 CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490  CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630   GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG480    GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGAAAGCCCAC+3626618836266196AK120318, J075055J16
 OsREG421AAAGCCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG427 AAGCCCAC PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.